ID: 1177949263

View in Genome Browser
Species Human (GRCh38)
Location 21:27513234-27513256
Sequence CAAAGCCCACATCAACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177949259_1177949263 -6 Left 1177949259 21:27513217-27513239 CCAGCTAAACTCCCAGCCAAAGC No data
Right 1177949263 21:27513234-27513256 CAAAGCCCACATCAACTGCCAGG No data
1177949258_1177949263 22 Left 1177949258 21:27513189-27513211 CCACATGTAGACAATTTGGACAT No data
Right 1177949263 21:27513234-27513256 CAAAGCCCACATCAACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177949263 Original CRISPR CAAAGCCCACATCAACTGCC AGG Intergenic
No off target data available for this crispr