ID: 1177955512 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:27593520-27593542 |
| Sequence | GTCTACAACCAGAATGAGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177955512_1177955515 | 29 | Left | 1177955512 | 21:27593520-27593542 | CCAGGCTCATTCTGGTTGTAGAC | No data | ||
| Right | 1177955515 | 21:27593572-27593594 | CAAGGTCCCAATTTCCTTGCTGG | No data | ||||
| 1177955512_1177955514 | 11 | Left | 1177955512 | 21:27593520-27593542 | CCAGGCTCATTCTGGTTGTAGAC | No data | ||
| Right | 1177955514 | 21:27593554-27593576 | TCTTGTGCTTTTTGTGATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177955512 | Original CRISPR | GTCTACAACCAGAATGAGCC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||