ID: 1177955512

View in Genome Browser
Species Human (GRCh38)
Location 21:27593520-27593542
Sequence GTCTACAACCAGAATGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177955512_1177955515 29 Left 1177955512 21:27593520-27593542 CCAGGCTCATTCTGGTTGTAGAC No data
Right 1177955515 21:27593572-27593594 CAAGGTCCCAATTTCCTTGCTGG No data
1177955512_1177955514 11 Left 1177955512 21:27593520-27593542 CCAGGCTCATTCTGGTTGTAGAC No data
Right 1177955514 21:27593554-27593576 TCTTGTGCTTTTTGTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177955512 Original CRISPR GTCTACAACCAGAATGAGCC TGG (reversed) Intergenic
No off target data available for this crispr