ID: 1177955727

View in Genome Browser
Species Human (GRCh38)
Location 21:27596179-27596201
Sequence ACTTCAGATGTGTTTGCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177955723_1177955727 14 Left 1177955723 21:27596142-27596164 CCCCCTGAACTGTAGTGCTTTTC No data
Right 1177955727 21:27596179-27596201 ACTTCAGATGTGTTTGCTTAAGG No data
1177955725_1177955727 12 Left 1177955725 21:27596144-27596166 CCCTGAACTGTAGTGCTTTTCTA No data
Right 1177955727 21:27596179-27596201 ACTTCAGATGTGTTTGCTTAAGG No data
1177955726_1177955727 11 Left 1177955726 21:27596145-27596167 CCTGAACTGTAGTGCTTTTCTAA No data
Right 1177955727 21:27596179-27596201 ACTTCAGATGTGTTTGCTTAAGG No data
1177955724_1177955727 13 Left 1177955724 21:27596143-27596165 CCCCTGAACTGTAGTGCTTTTCT No data
Right 1177955727 21:27596179-27596201 ACTTCAGATGTGTTTGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177955727 Original CRISPR ACTTCAGATGTGTTTGCTTA AGG Intergenic