ID: 1177960443

View in Genome Browser
Species Human (GRCh38)
Location 21:27660120-27660142
Sequence GTGTTTGCAAAAATGCTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177960443_1177960445 2 Left 1177960443 21:27660120-27660142 CCTACTAGCATTTTTGCAAACAC No data
Right 1177960445 21:27660145-27660167 GATTTGCATGCCTGGAAATAAGG No data
1177960443_1177960444 -6 Left 1177960443 21:27660120-27660142 CCTACTAGCATTTTTGCAAACAC No data
Right 1177960444 21:27660137-27660159 AAACACTTGATTTGCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177960443 Original CRISPR GTGTTTGCAAAAATGCTAGT AGG (reversed) Intergenic
No off target data available for this crispr