ID: 1177960444

View in Genome Browser
Species Human (GRCh38)
Location 21:27660137-27660159
Sequence AAACACTTGATTTGCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177960443_1177960444 -6 Left 1177960443 21:27660120-27660142 CCTACTAGCATTTTTGCAAACAC No data
Right 1177960444 21:27660137-27660159 AAACACTTGATTTGCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177960444 Original CRISPR AAACACTTGATTTGCATGCC TGG Intergenic