ID: 1177960445 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:27660145-27660167 |
| Sequence | GATTTGCATGCCTGGAAATA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177960443_1177960445 | 2 | Left | 1177960443 | 21:27660120-27660142 | CCTACTAGCATTTTTGCAAACAC | No data | ||
| Right | 1177960445 | 21:27660145-27660167 | GATTTGCATGCCTGGAAATAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177960445 | Original CRISPR | GATTTGCATGCCTGGAAATA AGG | Intergenic | ||