ID: 1177962526

View in Genome Browser
Species Human (GRCh38)
Location 21:27685098-27685120
Sequence CACAAGAAAGTACAAACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177962523_1177962526 -6 Left 1177962523 21:27685081-27685103 CCATTTACCCAGAAAAACACAAG No data
Right 1177962526 21:27685098-27685120 CACAAGAAAGTACAAACCCAAGG No data
1177962522_1177962526 -5 Left 1177962522 21:27685080-27685102 CCCATTTACCCAGAAAAACACAA No data
Right 1177962526 21:27685098-27685120 CACAAGAAAGTACAAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177962526 Original CRISPR CACAAGAAAGTACAAACCCA AGG Intergenic
No off target data available for this crispr