ID: 1177965127

View in Genome Browser
Species Human (GRCh38)
Location 21:27718298-27718320
Sequence ACAAATGCATAGTTTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177965127_1177965130 -7 Left 1177965127 21:27718298-27718320 CCCTGCAGAAACTATGCATTTGT No data
Right 1177965130 21:27718314-27718336 CATTTGTAACTGATATGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177965127 Original CRISPR ACAAATGCATAGTTTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr