ID: 1177971802

View in Genome Browser
Species Human (GRCh38)
Location 21:27799175-27799197
Sequence GGCTAGGTACTCTCCACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177971797_1177971802 3 Left 1177971797 21:27799149-27799171 CCACAGGTGCATAAGGGCACTGC No data
Right 1177971802 21:27799175-27799197 GGCTAGGTACTCTCCACAGTAGG No data
1177971791_1177971802 25 Left 1177971791 21:27799127-27799149 CCCTTGCTCATGCACATCATGCC No data
Right 1177971802 21:27799175-27799197 GGCTAGGTACTCTCCACAGTAGG No data
1177971796_1177971802 4 Left 1177971796 21:27799148-27799170 CCCACAGGTGCATAAGGGCACTG No data
Right 1177971802 21:27799175-27799197 GGCTAGGTACTCTCCACAGTAGG No data
1177971792_1177971802 24 Left 1177971792 21:27799128-27799150 CCTTGCTCATGCACATCATGCCC No data
Right 1177971802 21:27799175-27799197 GGCTAGGTACTCTCCACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177971802 Original CRISPR GGCTAGGTACTCTCCACAGT AGG Intergenic