ID: 1177972825

View in Genome Browser
Species Human (GRCh38)
Location 21:27811289-27811311
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177972817_1177972825 25 Left 1177972817 21:27811241-27811263 CCTGAACACATTAAGGTAGCTTC No data
Right 1177972825 21:27811289-27811311 GGCAAATGTTCTTGGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177972825 Original CRISPR GGCAAATGTTCTTGGTATGT GGG Intergenic
No off target data available for this crispr