ID: 1177982497

View in Genome Browser
Species Human (GRCh38)
Location 21:27931800-27931822
Sequence GGATATAAGCAGAAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177982497_1177982501 17 Left 1177982497 21:27931800-27931822 CCATCCATCTTCTGCTTATATCC No data
Right 1177982501 21:27931840-27931862 ATTATTCTATTTACATTATTCGG No data
1177982497_1177982502 18 Left 1177982497 21:27931800-27931822 CCATCCATCTTCTGCTTATATCC No data
Right 1177982502 21:27931841-27931863 TTATTCTATTTACATTATTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177982497 Original CRISPR GGATATAAGCAGAAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr