ID: 1177984867

View in Genome Browser
Species Human (GRCh38)
Location 21:27961915-27961937
Sequence AACCCAGTAGGTGGTAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177984859_1177984867 11 Left 1177984859 21:27961881-27961903 CCTCCCAAGTTCAAGCAATCCTC 0: 50
1: 1852
2: 28837
3: 80379
4: 155933
Right 1177984867 21:27961915-27961937 AACCCAGTAGGTGGTAACACAGG No data
1177984858_1177984867 17 Left 1177984858 21:27961875-27961897 CCTCTGCCTCCCAAGTTCAAGCA 0: 386
1: 10487
2: 35992
3: 80623
4: 117534
Right 1177984867 21:27961915-27961937 AACCCAGTAGGTGGTAACACAGG No data
1177984861_1177984867 7 Left 1177984861 21:27961885-27961907 CCAAGTTCAAGCAATCCTCCCAT No data
Right 1177984867 21:27961915-27961937 AACCCAGTAGGTGGTAACACAGG No data
1177984862_1177984867 -8 Left 1177984862 21:27961900-27961922 CCTCCCATCTCAGCTAACCCAGT No data
Right 1177984867 21:27961915-27961937 AACCCAGTAGGTGGTAACACAGG No data
1177984860_1177984867 8 Left 1177984860 21:27961884-27961906 CCCAAGTTCAAGCAATCCTCCCA No data
Right 1177984867 21:27961915-27961937 AACCCAGTAGGTGGTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177984867 Original CRISPR AACCCAGTAGGTGGTAACAC AGG Intergenic
No off target data available for this crispr