ID: 1177991071

View in Genome Browser
Species Human (GRCh38)
Location 21:28037129-28037151
Sequence GACAGCTTGTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991071_1177991073 11 Left 1177991071 21:28037129-28037151 CCAGTAACAGGCCACAAGCTGTC No data
Right 1177991073 21:28037163-28037185 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
1177991071_1177991074 15 Left 1177991071 21:28037129-28037151 CCAGTAACAGGCCACAAGCTGTC No data
Right 1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
1177991071_1177991075 16 Left 1177991071 21:28037129-28037151 CCAGTAACAGGCCACAAGCTGTC No data
Right 1177991075 21:28037168-28037190 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991071 Original CRISPR GACAGCTTGTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr