ID: 1177991371

View in Genome Browser
Species Human (GRCh38)
Location 21:28039557-28039579
Sequence CCCAGTTGGCCCCCCCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991371_1177991385 23 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991385 21:28039603-28039625 GAAGCAAACAGGGGTGTTGGGGG 0: 72
1: 124
2: 116
3: 85
4: 338
1177991371_1177991378 13 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991378 21:28039593-28039615 TATAGGCCCAGAAGCAAACAGGG No data
1177991371_1177991377 12 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991377 21:28039592-28039614 TTATAGGCCCAGAAGCAAACAGG No data
1177991371_1177991383 21 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991383 21:28039601-28039623 CAGAAGCAAACAGGGGTGTTGGG No data
1177991371_1177991386 26 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991386 21:28039606-28039628 GCAAACAGGGGTGTTGGGGGTGG 0: 60
1: 109
2: 122
3: 111
4: 427
1177991371_1177991379 14 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991379 21:28039594-28039616 ATAGGCCCAGAAGCAAACAGGGG No data
1177991371_1177991384 22 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991384 21:28039602-28039624 AGAAGCAAACAGGGGTGTTGGGG 0: 77
1: 153
2: 117
3: 108
4: 406
1177991371_1177991382 20 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991382 21:28039600-28039622 CCAGAAGCAAACAGGGGTGTTGG No data
1177991371_1177991376 -4 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991376 21:28039576-28039598 TGGGACTTTAGACTAGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991371 Original CRISPR CCCAGTTGGCCCCCCCTAAG GGG (reversed) Intergenic
No off target data available for this crispr