ID: 1177991373

View in Genome Browser
Species Human (GRCh38)
Location 21:28039558-28039580
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991373_1177991376 -5 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991376 21:28039576-28039598 TGGGACTTTAGACTAGTTATAGG No data
1177991373_1177991384 21 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991384 21:28039602-28039624 AGAAGCAAACAGGGGTGTTGGGG No data
1177991373_1177991386 25 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991386 21:28039606-28039628 GCAAACAGGGGTGTTGGGGGTGG No data
1177991373_1177991382 19 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991382 21:28039600-28039622 CCAGAAGCAAACAGGGGTGTTGG No data
1177991373_1177991385 22 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991385 21:28039603-28039625 GAAGCAAACAGGGGTGTTGGGGG No data
1177991373_1177991378 12 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991378 21:28039593-28039615 TATAGGCCCAGAAGCAAACAGGG No data
1177991373_1177991377 11 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991377 21:28039592-28039614 TTATAGGCCCAGAAGCAAACAGG No data
1177991373_1177991383 20 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991383 21:28039601-28039623 CAGAAGCAAACAGGGGTGTTGGG No data
1177991373_1177991379 13 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991379 21:28039594-28039616 ATAGGCCCAGAAGCAAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991373 Original CRISPR TCCCAGTTGGCCCCCCCTAA GGG (reversed) Intergenic