ID: 1177991376

View in Genome Browser
Species Human (GRCh38)
Location 21:28039576-28039598
Sequence TGGGACTTTAGACTAGTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991371_1177991376 -4 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991376 21:28039576-28039598 TGGGACTTTAGACTAGTTATAGG No data
1177991362_1177991376 20 Left 1177991362 21:28039533-28039555 CCTCATAGGTCACACTCTCAACC 0: 7
1: 92
2: 129
3: 123
4: 192
Right 1177991376 21:28039576-28039598 TGGGACTTTAGACTAGTTATAGG No data
1177991374_1177991376 -6 Left 1177991374 21:28039559-28039581 CCTTAGGGGGGGCCAACTGGGAC No data
Right 1177991376 21:28039576-28039598 TGGGACTTTAGACTAGTTATAGG No data
1177991373_1177991376 -5 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991376 21:28039576-28039598 TGGGACTTTAGACTAGTTATAGG No data
1177991369_1177991376 -1 Left 1177991369 21:28039554-28039576 CCTCCCCTTAGGGGGGGCCAACT No data
Right 1177991376 21:28039576-28039598 TGGGACTTTAGACTAGTTATAGG No data
1177991361_1177991376 23 Left 1177991361 21:28039530-28039552 CCTCCTCATAGGTCACACTCTCA 0: 8
1: 96
2: 135
3: 110
4: 199
Right 1177991376 21:28039576-28039598 TGGGACTTTAGACTAGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991376 Original CRISPR TGGGACTTTAGACTAGTTAT AGG Intergenic
No off target data available for this crispr