ID: 1177991379

View in Genome Browser
Species Human (GRCh38)
Location 21:28039594-28039616
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991375_1177991379 0 Left 1177991375 21:28039571-28039593 CCAACTGGGACTTTAGACTAGTT No data
Right 1177991379 21:28039594-28039616 ATAGGCCCAGAAGCAAACAGGGG No data
1177991373_1177991379 13 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991379 21:28039594-28039616 ATAGGCCCAGAAGCAAACAGGGG No data
1177991369_1177991379 17 Left 1177991369 21:28039554-28039576 CCTCCCCTTAGGGGGGGCCAACT No data
Right 1177991379 21:28039594-28039616 ATAGGCCCAGAAGCAAACAGGGG No data
1177991374_1177991379 12 Left 1177991374 21:28039559-28039581 CCTTAGGGGGGGCCAACTGGGAC No data
Right 1177991379 21:28039594-28039616 ATAGGCCCAGAAGCAAACAGGGG No data
1177991371_1177991379 14 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991379 21:28039594-28039616 ATAGGCCCAGAAGCAAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991379 Original CRISPR ATAGGCCCAGAAGCAAACAG GGG Intergenic
No off target data available for this crispr