ID: 1177991384

View in Genome Browser
Species Human (GRCh38)
Location 21:28039602-28039624
Sequence AGAAGCAAACAGGGGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 861
Summary {0: 77, 1: 153, 2: 117, 3: 108, 4: 406}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991375_1177991384 8 Left 1177991375 21:28039571-28039593 CCAACTGGGACTTTAGACTAGTT No data
Right 1177991384 21:28039602-28039624 AGAAGCAAACAGGGGTGTTGGGG 0: 77
1: 153
2: 117
3: 108
4: 406
1177991369_1177991384 25 Left 1177991369 21:28039554-28039576 CCTCCCCTTAGGGGGGGCCAACT No data
Right 1177991384 21:28039602-28039624 AGAAGCAAACAGGGGTGTTGGGG 0: 77
1: 153
2: 117
3: 108
4: 406
1177991371_1177991384 22 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991384 21:28039602-28039624 AGAAGCAAACAGGGGTGTTGGGG 0: 77
1: 153
2: 117
3: 108
4: 406
1177991373_1177991384 21 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991384 21:28039602-28039624 AGAAGCAAACAGGGGTGTTGGGG 0: 77
1: 153
2: 117
3: 108
4: 406
1177991374_1177991384 20 Left 1177991374 21:28039559-28039581 CCTTAGGGGGGGCCAACTGGGAC No data
Right 1177991384 21:28039602-28039624 AGAAGCAAACAGGGGTGTTGGGG 0: 77
1: 153
2: 117
3: 108
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991384 Original CRISPR AGAAGCAAACAGGGGTGTTG GGG Intergenic
901125958 1:6928819-6928841 AGGAGCAAACAGAGGAGCTGGGG - Intronic
901904394 1:12395082-12395104 AGAAGCAAACAGGGGTGTTGGGG + Intronic
902843944 1:19094825-19094847 AGACACAAACAGGCCTGTTGTGG + Intronic
903066776 1:20704131-20704153 AGCAGCAGACGGGGGTGTGGTGG + Intronic
903221839 1:21873642-21873664 AGAAAGAAGCAGGGGTTTTGTGG + Intronic
904214161 1:28906274-28906296 ATAAGGAAGCAGGGGTATTGGGG - Intronic
905353752 1:37366359-37366381 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
905464892 1:38145683-38145705 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
906465445 1:46074537-46074559 AGAAGCAAAGAGGTGTGGTGGGG + Intronic
906782805 1:48587336-48587358 AGAAGCAAGCAGAGTTCTTGAGG + Intronic
906867768 1:49441093-49441115 TGAAGCTAACAGGGGTGTTGTGG - Intronic
906879373 1:49574060-49574082 AGAAGCAAACAGCGGTGTTGGGG - Intronic
907467808 1:54651087-54651109 AGAACCACACAGTGGTGGTGGGG - Intronic
907597006 1:55729234-55729256 AGAAGCAAACAGAAGTGTTAAGG - Intergenic
907780015 1:57558357-57558379 GGAAGCAAACAGGGATGTTGTGG - Intronic
908011914 1:59786654-59786676 AGGAGGAAAAAGTGGTGTTGTGG - Intergenic
908616567 1:65929133-65929155 AGAAGCAAACAGGCAGGTTGGGG + Intronic
909172925 1:72317871-72317893 AAACGCAAACAGGGGTGTTGGGG + Intergenic
909549274 1:76879578-76879600 AGAAGCAAACAGGGGTGTTGGGG + Intronic
909810694 1:79929151-79929173 AGAAGCAAACAGGTGTGTTGTGG - Intergenic
910561536 1:88597267-88597289 AGAAGCAAATAGGAGTATTGGGG - Intergenic
910587884 1:88899313-88899335 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
910790007 1:91041425-91041447 AAAAGCAAACAGGGGTATTGGGG - Intergenic
910831477 1:91466131-91466153 AGAAGCAAACTCGGGTGTTGAGG + Intergenic
911883253 1:103268055-103268077 AGAAGCAAATAGGGGTGTTGGGG - Intergenic
911980152 1:104557250-104557272 AGAAGGAAACAGGGGTGTTGGGG - Intergenic
912050984 1:105527363-105527385 AGAAACAAACAGGGGTGTTGGGG + Intergenic
912071019 1:105809811-105809833 AGAAGCAAAAAGGAGCCTTGGGG + Intergenic
912195616 1:107393825-107393847 AGAAGCCAACATGGTTGTTAAGG + Intronic
912252155 1:108022227-108022249 AGAAGCAAACAGGGATGTTGGGG + Intergenic
912411433 1:109483391-109483413 TGAAGGACACAGGGGTGGTGTGG - Intergenic
912733646 1:112131241-112131263 AAAAGCAAATAGGGGTGTTGGGG + Intergenic
912944143 1:114070591-114070613 AGAAGGAAACAGGGGTGTTGGGG + Intergenic
913237470 1:116797346-116797368 GGAAGCCAATAGGGATGTTGAGG + Intergenic
913519829 1:119634215-119634237 ATAAGGAGAGAGGGGTGTTGGGG + Intronic
913718837 1:121569997-121570019 AGAAGCAAAAAGTGGTGGTGTGG + Intergenic
915299039 1:154941679-154941701 AGAAGCCAATAGGGGTGGTCAGG + Intergenic
915318559 1:155043356-155043378 AGAAGCAGGCTGGGGTGCTGGGG + Exonic
915667988 1:157462071-157462093 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
916200929 1:162271174-162271196 AGGATCATACTGGGGTGTTGGGG - Intronic
916683378 1:167123909-167123931 ATAAACAAACAAGGGTGTGGTGG - Intronic
916752364 1:167734682-167734704 AGAAGCAAAGAGAGGCGTTGGGG + Intronic
917052774 1:170942259-170942281 AGAAGCAAAGAAGAGTGGTGGGG + Intronic
917217539 1:172693323-172693345 AGAAGCAAACAGGGGATTTGGGG + Intergenic
917282880 1:173396045-173396067 AGAAGCAAAGAGAGGTGGTGAGG - Intergenic
917311891 1:173687458-173687480 AGAAGAAAAAAGGGGTGGGGGGG - Intergenic
917407816 1:174727081-174727103 AGAAGGAAACAGAGGTGCTAAGG - Intronic
917462406 1:175243798-175243820 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
917681860 1:177375608-177375630 AGAAGGAAAAAGTGGTTTTGTGG - Intergenic
918577782 1:186084548-186084570 AGAAGCAAGCAGAGTTGTAGAGG - Intronic
918756032 1:188340213-188340235 AGAAGAAAACAGGAGTGTTGGGG + Intergenic
918774201 1:188608349-188608371 AGAAGCAAACAGAGATGTTGGGG - Intergenic
918814791 1:189168816-189168838 AGAAGCAAACAGGAGCGTTGGGG - Intergenic
918918524 1:190674252-190674274 AGACGTGAACAGGGATGTTGGGG + Intergenic
918957952 1:191235609-191235631 AGAAGCAAAGAGAGGTGTTGGGG - Intergenic
919124972 1:193382562-193382584 AGAAGCAATAAGGGGTGTTGGGG + Intergenic
919194320 1:194264020-194264042 AGAAGGAAAAAGTGGTTTTGTGG + Intergenic
919230324 1:194764977-194764999 AGAAGCAATCAGGTGTGTTTGGG + Intergenic
919241488 1:194922083-194922105 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
920197101 1:204235947-204235969 AGAAGCAAACAGAGGTGTTGGGG - Intronic
920275293 1:204799957-204799979 AGAAGCAAACAGAGGCACTGGGG - Intergenic
921167351 1:212516661-212516683 AGAAGCAAAAAGGGTGGTTCAGG + Intergenic
922224863 1:223637401-223637423 AGGAGCAAACAGGAGTACTGAGG - Intronic
922525489 1:226299596-226299618 ACAAACAAACTGGGGTGTTCTGG + Intronic
924169319 1:241320808-241320830 AGGAACAAAAAGGGGTGCTGTGG + Intronic
924847504 1:247787950-247787972 AGAAACAAACATAGGTGTTGGGG + Intergenic
1063019114 10:2108372-2108394 AGTTACAAACAGGGGTGATGAGG + Intergenic
1063948860 10:11204033-11204055 AGAAGAAAACGGGGCTGATGTGG - Intronic
1064429572 10:15259084-15259106 AGAATCAAAACTGGGTGTTGGGG - Intronic
1064517973 10:16170653-16170675 AGAAGCAAACAGGGGTGTTAGGG + Intergenic
1065277061 10:24096149-24096171 AGAAGCAGGCATGGGTGTGGAGG - Intronic
1066002089 10:31114214-31114236 AGAAGCAAAGAGGGGTAGGGGGG + Intergenic
1066251205 10:33634446-33634468 AGAAGCACCCAGGAGTGTTTGGG + Intergenic
1066354969 10:34674437-34674459 AGAAGAAAACAGCTGTATTGAGG - Intronic
1066528842 10:36313857-36313879 AGAAGCAAACAGAGTGGGTGGGG - Intergenic
1067332830 10:45337799-45337821 AGAAGCAGACAGGGGTGTTGGGG - Intergenic
1068225663 10:54104043-54104065 AGAAGCAAACAGGAGTGTTGGGG + Intronic
1068446892 10:57136165-57136187 CGAAGCAAACGGGGGTGTTGAGG - Intergenic
1068837561 10:61571012-61571034 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1069791098 10:71021506-71021528 AGAAGCAAACAGGGGTATTGGGG + Intergenic
1070051651 10:72895531-72895553 GGAAGCAAAGTGGGGTGATGAGG + Intronic
1070742635 10:78912910-78912932 AGAAGCAAGCAGAGGGGTAGGGG + Intergenic
1071267411 10:83976412-83976434 AGAAGCAAACAGGGGTGTTTGGG + Intergenic
1071378072 10:85030999-85031021 AAAAGCAAACAGGGGTGTTGGGG - Intergenic
1071943099 10:90610194-90610216 AGGAGCAAACAGGGGTGTTGAGG + Intergenic
1072099919 10:92219420-92219442 TGAAGCATACAAGGGGGTTGAGG - Intronic
1072209584 10:93234109-93234131 GGAAGCAAACAGAGGTGTTGAGG + Intergenic
1072360159 10:94651729-94651751 TGAAGCAAACAGGAGTGTTGGGG - Intergenic
1073151779 10:101316589-101316611 AACAGGAAAGAGGGGTGTTGTGG + Intergenic
1073355213 10:102848394-102848416 AGAGACAAAGAGGTGTGTTGTGG + Intergenic
1073557009 10:104463484-104463506 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1073656982 10:105426728-105426750 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1073806931 10:107108433-107108455 AGAAGCAAACAAGAGAGTAGTGG + Intronic
1073998538 10:109343446-109343468 AAATGCAAACAGCTGTGTTGTGG + Intergenic
1074018610 10:109561432-109561454 AGAAGATATCAGGAGTGTTGGGG + Intergenic
1074244627 10:111676445-111676467 AGAAGCAAACAGGGATGTTGGGG - Intergenic
1074386386 10:113019937-113019959 AGAAACCAACAGGGGGGTTCTGG - Intronic
1075606552 10:123815697-123815719 AGAAGGAAACAGGGGTGTTGGGG - Intronic
1076045695 10:127292523-127292545 AGGAGCAAACAGGGGCCTTGGGG + Intronic
1076122833 10:127950028-127950050 AGAAGGAAAGAGGGTTGGTGGGG - Intronic
1076310413 10:129502262-129502284 AGAAGCAGACAGGGAGGTTACGG - Intronic
1076571055 10:131433080-131433102 AAAAGCAAAACGGGGTGTGGTGG + Intergenic
1077183783 11:1227646-1227668 GGAAGAAAGCAGGGGTGTGGTGG - Intronic
1077380572 11:2235128-2235150 AGAAGCAAAGGGAGGTGGTGGGG - Intergenic
1077443752 11:2580764-2580786 TGAAGAAAGCAGGGGTGGTGGGG - Intronic
1077472749 11:2771941-2771963 AGAAGCAGACAGTGGGGTGGGGG - Intronic
1077604611 11:3600423-3600445 AGAAGTACACGGGGGTGTGGAGG + Intergenic
1077669126 11:4141828-4141850 AGAACCAAAGAGGGGTGGTCAGG - Intergenic
1077801744 11:5545974-5545996 AGAAGCAAACAGTTGTCTTGGGG - Intronic
1078922149 11:15840885-15840907 AGTACAAAACAGGGGTGATGGGG + Intergenic
1079838693 11:25367074-25367096 AGAAGGAAAAAGTGGTTTTGTGG - Intergenic
1080709558 11:34733958-34733980 AGAACCAAACAGGCGGGCTGCGG - Intergenic
1080976525 11:37349418-37349440 AGAAACAAACAGGGGTGTTGGGG - Intergenic
1081072474 11:38628674-38628696 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1081350761 11:42049682-42049704 AGAAGCAGACAGTGCTTTTGAGG - Intergenic
1081590061 11:44416373-44416395 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1082671378 11:56040616-56040638 AGAAGTAAACAGGAGTGTCTGGG - Intergenic
1082999305 11:59277114-59277136 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1083882891 11:65557308-65557330 AGGAGCACACAGGGTTTTTGAGG - Intronic
1084603338 11:70159298-70159320 AGATGCAAGCAGAGGTGTGGTGG - Intronic
1084812266 11:71620231-71620253 AGAAGCACATGGGGGTGTGGAGG - Intergenic
1085747255 11:79125810-79125832 AGAAGCAAACAGGGGTGTTGGGG - Intronic
1086055987 11:82647025-82647047 AGAAGAAAACAGGGGAGATTAGG + Intergenic
1086278311 11:85158033-85158055 AGAAGCAAACAGGGCTGTTGGGG - Intronic
1086759004 11:90603632-90603654 AGAAGGAAAAAGTGGTTTTGTGG + Intergenic
1086833809 11:91597960-91597982 AGAAGCAAACAGCATTGTTGGGG - Intergenic
1086961875 11:92986271-92986293 AGAAGCAAACAGAGGTGCTGGGG + Intergenic
1087126051 11:94626551-94626573 AGAAGGAAAAAGTGGTTTTGTGG - Intergenic
1088192007 11:107236935-107236957 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1088264824 11:107979113-107979135 AGAAACAAGCAGGGGTGTTGGGG - Intergenic
1088449029 11:109962912-109962934 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1089027477 11:115286800-115286822 AGGAAGAAGCAGGGGTGTTGGGG + Intronic
1089080462 11:115772315-115772337 AGAAGGAACCAGTGGAGTTGGGG - Intergenic
1089469337 11:118708260-118708282 AGAAGCAAAGAGAGGGGTTATGG - Intergenic
1090209975 11:124912205-124912227 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1090221921 11:125034026-125034048 AGAAGCAAACAGAGGTGTTGGGG + Intronic
1090524790 11:127521765-127521787 AGAAGCAATCAGAGGAGATGGGG - Intergenic
1091051415 11:132376312-132376334 AGAAGCAAACAGGGTGTTGGGGG - Intergenic
1091212149 11:133871305-133871327 AGAAGAAAAAAGGGGTGGTGGGG - Intergenic
1091325267 11:134682217-134682239 AGATGAAAATAGGGGTATTGAGG - Intergenic
1092092947 12:5819196-5819218 AGAAGCAAACAGGGGTGTTGGGG - Intronic
1092271096 12:7023975-7023997 AGAAGCAAAGAGGGCAGGTGGGG - Intronic
1092656453 12:10689950-10689972 AGAAGAAAATAAGGGTGTTGAGG + Intergenic
1092905787 12:13099558-13099580 AAGAGAAAACAGTGGTGTTGGGG + Intronic
1092922865 12:13247827-13247849 AGAAACAAAGAGGGGAGGTGAGG + Intergenic
1093035933 12:14332604-14332626 AGAAGCAAACAGACGTGTTCGGG - Intergenic
1093964231 12:25308510-25308532 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1094102218 12:26776829-26776851 AGAAGCAAACAGGGGTGTTGAGG - Intronic
1094489290 12:30948656-30948678 AGAAGGAAAAAGTGGTTTTGTGG - Intronic
1094561516 12:31558269-31558291 AAAAGAAAACAAGGGGGTTGGGG - Intronic
1094691017 12:32769015-32769037 AGCAGCAATCAGGAATGTTGAGG - Intergenic
1095252579 12:39996561-39996583 AGAAGGAAAAAGTGGTTTTGTGG + Intronic
1095603759 12:44043663-44043685 AGAAGCAAATAGGGGTGTTGGGG - Intronic
1095654626 12:44654662-44654684 AGAAGCACACAGGAGAGATGAGG + Intronic
1095844793 12:46732923-46732945 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1095856547 12:46866103-46866125 AGAGGCAAACAGGGGTGTTGGGG + Intergenic
1096457853 12:51802164-51802186 AGAAACAAACAGGGGTGTTGGGG + Intronic
1096487404 12:51992800-51992822 AGATGAAATCAGGGGTGTGGGGG + Intronic
1097076540 12:56399056-56399078 AGAAGCAAATAGGGGTGTTGGGG - Intergenic
1097431824 12:59518653-59518675 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1098093469 12:66929204-66929226 AGAAGCAAACAAAGGCATTGAGG - Intergenic
1098715728 12:73827007-73827029 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1098730752 12:74034932-74034954 AGAAGCAAACAGGGGTATTGAGG - Intergenic
1098749518 12:74277058-74277080 AGAAACAAACAGGGGTGTTGGGG - Intergenic
1098805137 12:75013641-75013663 AGAAGAAAACAGGGGTGTTGGGG - Intergenic
1098832221 12:75376469-75376491 AGAAGCAAACAGCAGTGTTGAGG + Intronic
1099031981 12:77537591-77537613 AGAAGCAAACTGCTGTGTTATGG - Intergenic
1099104305 12:78480525-78480547 TGAAGCAAGCAGAGGTGTTTTGG - Intergenic
1099184107 12:79499105-79499127 AAAAGCAAACAGGGGTGCTGTGG + Intergenic
1099350703 12:81565274-81565296 AGAAGCAAACAGGAGTGTTGGGG - Intronic
1099375330 12:81891537-81891559 AAAAGCAAACAGGGATGTTGGGG - Intergenic
1099379980 12:81941175-81941197 AGAAGCAAACAGGTGTGTTGGGG + Intergenic
1099401427 12:82207130-82207152 AGAAGCAAACAGGGGTGTTCAGG + Intergenic
1099407863 12:82285180-82285202 AGAAGGAAAAAGTGGTTTTGTGG + Intronic
1099735459 12:86562622-86562644 AGAAGCAAACAGAGGTGTTGGGG - Intronic
1100083002 12:90875801-90875823 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1100241496 12:92714127-92714149 AGAGGCAAACAAGGTTGTTGGGG + Intergenic
1100712931 12:97276572-97276594 ACAAGCAACCATGTGTGTTGTGG + Intergenic
1101263802 12:103063673-103063695 AGAAGAAAACAGGGGTGTTCGGG - Intergenic
1101535006 12:105608544-105608566 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1103035237 12:117651295-117651317 AGAAGCAAACAGGGGTATTGGGG - Intronic
1103751148 12:123162769-123162791 AAAAGCTGACAGGGGTGCTGAGG + Intronic
1105700265 13:22930418-22930440 AGAGGCAAAGTGGGGTGGTGAGG + Intergenic
1105747751 13:23393447-23393469 AGCAGCGAACACGGGTGATGAGG - Intronic
1107039485 13:35933722-35933744 AGGAGGAAAAAGGGGTTTTGTGG - Intronic
1107424729 13:40281632-40281654 AGAAGCAAGCAGGGGTGTTGGGG + Intergenic
1107983895 13:45758406-45758428 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1108547280 13:51508494-51508516 AGAAGGAAACATGGGAGTTAAGG - Intergenic
1108914607 13:55591331-55591353 AGAAGCAAACAGGGGTTTTGGGG + Intergenic
1109459964 13:62643746-62643768 AGAAGCAAAGAGAGGTGCTGGGG - Intergenic
1109582738 13:64363706-64363728 AGAAGCAGACAGGGACGTTGGGG - Intergenic
1109704836 13:66076835-66076857 AGAAGCAAAGAGTGGTGGTAGGG - Intergenic
1109712991 13:66183416-66183438 AAAAGCAAATAGCCGTGTTGGGG + Intergenic
1109951331 13:69504597-69504619 AAAAGCAAACAGAGGTGTTGGGG + Intergenic
1111016498 13:82388259-82388281 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1111109047 13:83683848-83683870 AGAAGCAAATTGGGGTGGTGGGG - Intergenic
1111440774 13:88280735-88280757 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1111576069 13:90155198-90155220 AGGAGCCAACAGGGGTTTGGGGG + Intergenic
1112231458 13:97592590-97592612 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1113111865 13:106831917-106831939 AGAAGAAAAGAGGGGTGATGAGG + Intergenic
1113722467 13:112570030-112570052 AGAAGCAAGCAGGGCTGAAGGGG + Intronic
1114015554 14:18425508-18425530 AGAAGCCAGCAGTGGTGTTCTGG + Intergenic
1114017064 14:18440130-18440152 AGAAACCAACAGAGGTGTTCTGG + Intergenic
1114024049 14:18508234-18508256 AGAATCAAACAGCTGTGTTCTGG - Intergenic
1114205589 14:20568667-20568689 AGAAGCAGATAGGAGTGTTAGGG - Intergenic
1114758572 14:25286161-25286183 AAAAGCAAACAGAGGTGTTGGGG + Intergenic
1114965755 14:27957223-27957245 AGAAGAAAAGAGGAGTGATGTGG + Intergenic
1115677695 14:35697726-35697748 AGATGCAAATAGGTGTGTAGAGG - Intronic
1116131952 14:40865765-40865787 AGATCCAAACAGTGTTGTTGTGG - Intergenic
1116158706 14:41239106-41239128 AGAAGCAAACAGGAGAATTGGGG + Intergenic
1116414760 14:44666878-44666900 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1116531769 14:45980634-45980656 AGAAGAAAACAGGGGTGTTAGGG + Intergenic
1117001255 14:51373853-51373875 AGAAGCAAACAGGGGTGTTAGGG - Intergenic
1117216502 14:53557669-53557691 AGAAGCAAACAGAGGTGTTGAGG - Intergenic
1117596598 14:57332328-57332350 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1117633802 14:57721955-57721977 GGAAGAAAACAGGAGTGTTGGGG - Intronic
1118066004 14:62190702-62190724 AGAAGCAAGCAGAGGGGTGGAGG - Intergenic
1118881090 14:69826454-69826476 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1119060077 14:71464906-71464928 AGAAGCAAACAGGGGTGTTGAGG + Intronic
1119300561 14:73568231-73568253 AGAGGCAAACACAGGTTTTGTGG + Intronic
1120082346 14:80229976-80229998 AGAAGCAAACAGGGGTGTTGGGG + Intronic
1120320600 14:82956020-82956042 AAAAGCACACAGGATTGTTGTGG + Intergenic
1120857951 14:89229119-89229141 AGAAGGGAACAGAGGAGTTGAGG + Intronic
1120973333 14:90228020-90228042 AGAAGCAGACAGGGGTGTTGAGG - Intergenic
1121223124 14:92301379-92301401 GGAAGCAACAAGGGGTGCTGAGG + Intergenic
1121371047 14:93358855-93358877 AGAAGTAGACAAGGGTGTTGGGG - Intronic
1121831382 14:97055260-97055282 AGAAGAAAGAAGGGGTGTTGAGG - Intergenic
1122830747 14:104394458-104394480 AGCAGCAAGCAGGACTGTTGCGG - Intergenic
1122841788 14:104468383-104468405 AGAGGCAAAGAGGGGCGGTGAGG + Intergenic
1122965284 14:105121051-105121073 AGAGGCAAAAAGGGATGCTGAGG + Intergenic
1124530299 15:30499812-30499834 AAAAGCAAAGAGGGGTGGTGGGG - Intergenic
1124768360 15:32507876-32507898 AAAAGCAAAGAGGGGTGGTGGGG + Intergenic
1125233483 15:37484313-37484335 AGAAGGAAAAAGTGGTTTTGTGG - Intergenic
1125763722 15:42118745-42118767 AAGATCAAACAGGGGTGTGGAGG + Intergenic
1126280246 15:46938973-46938995 AGAAGCAAACATAGGTTTTAAGG + Intergenic
1126827002 15:52561611-52561633 AGAAATAAAAAGGAGTGTTGGGG + Intronic
1127118939 15:55754566-55754588 AGAAGAAAAAAGTGGTGGTGAGG + Intergenic
1127300947 15:57653085-57653107 ATAACAAAGCAGGGGTGTTGGGG + Intronic
1127837257 15:62799953-62799975 AGAGGCAGGCAGGGCTGTTGTGG + Intronic
1128373535 15:67059047-67059069 CTATGCATACAGGGGTGTTGTGG - Intergenic
1129961714 15:79692495-79692517 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1130153413 15:81329722-81329744 AGAGGCAAACAGCCATGTTGTGG + Intergenic
1130644217 15:85709491-85709513 AGAAGCAAGCTGGGGTGGGGTGG - Intronic
1130719347 15:86371752-86371774 AGACGCACAAAGGGGTGGTGTGG + Intronic
1131304902 15:91233795-91233817 AGAAGCAAAGAGGGGTGGAGGGG - Intronic
1131969980 15:97882080-97882102 AGAATCAAAAAGGGATGGTGGGG - Intergenic
1132041800 15:98531176-98531198 AGAAGTTAACAGGGGTTTCGGGG + Intergenic
1132085036 15:98901467-98901489 TGAAGCAAACAGAGCTCTTGGGG - Intronic
1133519865 16:6546522-6546544 AGAAGCAGACAGAGGTGCTATGG - Intronic
1133728013 16:8555272-8555294 AGAAGAAAACAGCTGTATTGAGG + Intergenic
1134196322 16:12162001-12162023 AGAAACCAACAGGGGTGGTGAGG - Intronic
1134681504 16:16129136-16129158 ACAAGCAAACAAAAGTGTTGGGG - Intronic
1134693084 16:16203779-16203801 AGAGGCAATCATGGGAGTTGGGG + Intronic
1136276769 16:29183434-29183456 AGAAGCAGAAAGGGTTGTTCAGG - Intergenic
1136776533 16:32874711-32874733 AGAAGCCATCAGGGCTGGTGAGG - Intergenic
1136894082 16:33986801-33986823 AGAAGCCATCAGGGCTGGTGAGG + Intergenic
1137327614 16:47457590-47457612 AGAGAGAAACAGGGGTGTGGGGG + Intronic
1137653525 16:50140589-50140611 AGAAGCAAAGGGGGTTGTTGAGG + Intergenic
1138217513 16:55217508-55217530 AAAAGCAAACAGCTGTGTTGTGG - Intergenic
1138548120 16:57731388-57731410 AGGAACAAACAGGGCTGTAGGGG - Exonic
1139190210 16:64854749-64854771 AGAAGTACACAGGTATGTTGTGG + Intergenic
1140231716 16:73122818-73122840 CCAAGCAAACAGTGGTGTGGAGG + Intergenic
1140261605 16:73385214-73385236 AGAAGCAAAAAGGGATGTGTGGG - Intergenic
1140597737 16:76436076-76436098 TAGAACAAACAGGGGTGTTGGGG + Intronic
1141559866 16:84860465-84860487 AGAAGCAAACAGGGATGTTGGGG + Intronic
1142081149 16:88149494-88149516 AGAAGCAGAAAGGGTTGTTCAGG - Intergenic
1142259978 16:89038142-89038164 AGAAGCAGAAAGGGAAGTTGAGG + Intergenic
1203078948 16_KI270728v1_random:1136820-1136842 AGAAGCCATCAGGGCTGGTGAGG - Intergenic
1142917618 17:3154657-3154679 AGAAGTACATAGGGGTGTGGAGG + Intergenic
1142945929 17:3427062-3427084 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1143145107 17:4770153-4770175 AGAAGCAAACAGGAGAGTGAAGG - Intergenic
1144679443 17:17183049-17183071 GGAAGCAGGCATGGGTGTTGAGG + Intronic
1145033167 17:19520679-19520701 AGAAGTACCCAGGGGTGTGGAGG + Intronic
1145120229 17:20252547-20252569 AGAAGCAGACAGTGGAGTGGTGG - Intronic
1146237877 17:31185187-31185209 AGAAGCAAACAGGGGTGTTGGGG - Intronic
1146640910 17:34540726-34540748 AGAAACTAAAAGGTGTGTTGGGG - Intergenic
1146669989 17:34730637-34730659 AGAAGGAAACTGGGGTGAGGAGG - Intergenic
1146758508 17:35454720-35454742 AGAAGCAAACAGGGTGTTGGGGG - Intergenic
1146850597 17:36218519-36218541 ACCACGAAACAGGGGTGTTGGGG - Intronic
1147862795 17:43533358-43533380 AGAAGGAGACAGGGGTGAGGGGG + Intronic
1148459638 17:47831739-47831761 GGCAGCAAGCTGGGGTGTTGTGG - Exonic
1149204461 17:54227866-54227888 AGAAGCAAAAAATGGTTTTGTGG + Intergenic
1149236331 17:54594680-54594702 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1151037937 17:70822651-70822673 AGAAGCAAACAGGAGTGTTGCGG + Intergenic
1151134713 17:71935114-71935136 AGCAGCAAAGGGAGGTGTTGAGG + Intergenic
1151253323 17:72854950-72854972 AAAAGCAGACACGGGTCTTGCGG + Intronic
1151327040 17:73385926-73385948 AGAAGCAGACAGGTGGGTTCTGG + Intronic
1151500230 17:74483676-74483698 AGAAGCACAGAGGTGTCTTGGGG + Intronic
1152162654 17:78678608-78678630 GGAAGAAAACAGCAGTGTTGTGG - Intronic
1152779786 17:82221746-82221768 AAAAACAAACAGGGCTGGTGTGG + Intergenic
1203157112 17_GL000205v2_random:14748-14770 AGAACCCAGCAGGGGTGTTCTGG + Intergenic
1203159038 17_GL000205v2_random:32184-32206 AGAAGACAGCAGGGGTGTTCTGG + Intergenic
1153461323 18:5336698-5336720 AGAAGCCAAGAGGGGTGATGCGG + Intergenic
1154068150 18:11128698-11128720 AGAAGCAAACAGAGGTGTTGGGG - Intronic
1154077291 18:11215911-11215933 AGAAGAAAACAGGGCTTTTTGGG + Intergenic
1154505876 18:15040430-15040452 AGAAGCAAACAGGAGTGTTGGGG - Intergenic
1155070461 18:22310775-22310797 AGAAGTAAACAGGGGCTTTTGGG - Intergenic
1155488224 18:26370571-26370593 AGAAGCAATGAGAGGTGGTGAGG - Intronic
1155573525 18:27220770-27220792 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1156192363 18:34734149-34734171 AGAAGCAAACAGAGGTATTGAGG + Intronic
1156303550 18:35856327-35856349 AGAAGCAAACAAGAGTGTTGGGG - Intergenic
1156537463 18:37878090-37878112 AGAAGCAAACAGGGGTCTTGGGG - Intergenic
1157476013 18:48024115-48024137 AGGAGGACACAGGGGAGTTGGGG + Intergenic
1159287476 18:66373028-66373050 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1159559406 18:69977600-69977622 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1160380850 18:78454227-78454249 AGAAACTGACAGGTGTGTTGTGG - Intergenic
1160497000 18:79381586-79381608 AGATGCGAACAGAAGTGTTGGGG + Intergenic
1160980279 19:1813417-1813439 AGAGGCAAACATGGGTGGAGGGG + Intergenic
1161418617 19:4162689-4162711 AGAAGAAAAGATGGGTGTGGTGG + Intronic
1161520354 19:4720353-4720375 AGGAGCGAGCAGGTGTGTTGAGG - Intronic
1161651232 19:5486585-5486607 AGAAGAAAACAGGGTTCTGGAGG - Intergenic
1161874981 19:6901390-6901412 AGAAGCCAACAGGTCTCTTGAGG + Intronic
1164097444 19:22024103-22024125 AGAAGCAAACAGGGGTGTTGAGG + Intergenic
1164117629 19:22237552-22237574 AGAAGCAAACAGGGGTGTTGAGG + Intergenic
1164200381 19:23013147-23013169 AGAAGCAAACATGGGTGTTGAGG + Intergenic
1164768981 19:30793350-30793372 AGAAGCAGAGAAGGGGGTTGGGG + Intergenic
1164824472 19:31274386-31274408 ATAAGCAGGCAGGGGTGTTGTGG - Intergenic
1164834257 19:31347729-31347751 AGAAGAAAACAGGGTTGGTTTGG - Intronic
1165428945 19:35760992-35761014 AGAAGCCACCAGGGATGATGTGG + Intronic
1165777539 19:38413476-38413498 TGGAGCAGACAGGGGTGTTACGG + Intronic
1166626274 19:44358906-44358928 AGAAGCGTATAGGGGTGGTGGGG + Intronic
1167530031 19:50009493-50009515 AGAAGCAAGAATTGGTGTTGAGG - Intronic
1167882307 19:52470257-52470279 AGAGGCAAAGAAGGGTGGTGGGG - Intronic
1168168204 19:54569294-54569316 AGAAGCAAAGAGGGTTGGTCAGG - Intergenic
1168183990 19:54685437-54685459 AGAAGCAAAGATGGGTAGTGGGG + Intronic
1168539685 19:57199780-57199802 AGAAGCAAACAAAGGTGTTGAGG + Intronic
925290267 2:2743427-2743449 AGAAGCACACAGGCCTTTTGAGG + Intergenic
925460405 2:4058036-4058058 AGAAGCAAACAAGGGTGTTGGGG - Intergenic
925499713 2:4489351-4489373 AGGAGCAAACAGGGGTGTTGGGG + Intergenic
925605298 2:5654194-5654216 TGAAGCCAAGGGGGGTGTTGTGG - Intergenic
926124322 2:10262614-10262636 AGAAGGAAAAGGGGGTGTGGAGG + Intergenic
926282437 2:11461022-11461044 AGAAGCAAAGAGGGGTGGCGGGG + Intronic
926644641 2:15276109-15276131 AGAAGAAAACATAGGTGCTGCGG - Intronic
926810712 2:16753123-16753145 AGAAGCAAACAGGGGTGGTGGGG + Intergenic
926825911 2:16904796-16904818 AGAAGGAAACGGGGGTTTTGGGG + Intergenic
927008584 2:18878670-18878692 AGAAGCAAACGGGGATGTTGGGG - Intergenic
927081678 2:19636571-19636593 GGAAGCAAACAGAGGTCTCGGGG + Intergenic
927226939 2:20776372-20776394 ATAAATAAACAGGGATGTTGTGG - Intronic
927413889 2:22856554-22856576 AGAAGCAAACAAGAGGGTAGAGG + Intergenic
927712009 2:25331973-25331995 AAAAGCAATGAGGGGAGTTGGGG - Intronic
928501714 2:31903408-31903430 AGAAAAAAACAGGGGGGTGGGGG + Intronic
930295466 2:49547988-49548010 AGAAGCAAACAGGGATATTAGGG + Intergenic
930456583 2:51614201-51614223 AGAAGCAAAAAGGGGTGTTGGGG + Intergenic
930903194 2:56533131-56533153 AGAAGCAAAGAAGGGTGGTGGGG + Intergenic
930909833 2:56618395-56618417 AGAAGCAAATGGGGGTGTTGGGG - Intergenic
931017801 2:58006005-58006027 GGAAGCAAAGAGAGGTGGTGGGG - Intronic
931447141 2:62336233-62336255 GGAAGCAGAGAGGGGTGTAGAGG - Intergenic
931869541 2:66443972-66443994 GGGAGCAAACGGTGGTGTTGGGG - Intronic
932350704 2:71029090-71029112 AGAAGCACATTGGGGTGTGGAGG - Intergenic
932596436 2:73096400-73096422 AGAGACAGACAGGGGTGTGGGGG + Intronic
932870796 2:75395831-75395853 AGAAGCAAACAAAGGTGTTGGGG + Intergenic
933266021 2:80181155-80181177 AGAAGCAAACAGGTTTGGGGTGG + Intronic
934590601 2:95546748-95546770 AGAAGCACATGGGGGTGTGGAGG - Intergenic
935079328 2:99776985-99777007 AGAAGCTTACAGGGCAGTTGGGG + Intronic
935183731 2:100713366-100713388 AGAAGCAAAAAGGGGTGTTGGGG - Intergenic
935425420 2:102913764-102913786 AGAAGCAAACAGAGGTGTCGGGG + Intergenic
935564633 2:104592672-104592694 AGAAGCAAACACGGGTGTTGTGG + Intergenic
936640969 2:114312590-114312612 AGAAGCAAACAGGGGTATTGCGG - Intergenic
937800015 2:126072309-126072331 AGAAGCAAACAGGGGTTTTGGGG - Intergenic
937851397 2:126639444-126639466 AGAAGCACAGAGGGAGGTTGGGG - Intergenic
937852880 2:126651156-126651178 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
938743474 2:134254589-134254611 AGAAGAAAACAGGAATGTGGTGG + Exonic
938949622 2:136244481-136244503 ACAAGCACAAAGGGGTGGTGTGG - Intergenic
939068769 2:137515419-137515441 AGAAGCAAACAGGGGTGTTAGGG - Intronic
939086197 2:137721265-137721287 AGAAGAAAACAGGGGTGTTGGGG - Intergenic
939213502 2:139209480-139209502 AGAAGAAAACAGGGGTGTTGGGG - Intergenic
939788997 2:146548517-146548539 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
939805930 2:146776036-146776058 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
940171645 2:150835158-150835180 AGAAGCAAACAGGAGTGTTGGGG + Intergenic
940606234 2:155926796-155926818 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
940870228 2:158853772-158853794 AGAAGTACACGGGGGTGTGGAGG - Intronic
941876222 2:170436199-170436221 AGAAGCACAGAAGGGTGTTCTGG + Intronic
942987605 2:182161613-182161635 AGAAGCAAAGAGGGGTGGTAGGG - Intronic
942989128 2:182178327-182178349 AGAAGCAAAAAGGGGTATGAAGG + Intronic
943006237 2:182390959-182390981 AGAAGCAAACAGGGCTGTTGTGG - Intronic
943011226 2:182452184-182452206 AGAAACAAACTGTGGTGCTGAGG + Intronic
943239522 2:185365034-185365056 AGAAGCAAACATGGGTGTTAGGG + Intergenic
943384335 2:187183295-187183317 AGGAGCAAACGGGGATGTTGGGG + Intergenic
943509161 2:188802852-188802874 AGAAGCAAACAGAAGTGTTGGGG - Intergenic
943517911 2:188909681-188909703 AGAAGCAAACAGGGATGTTGGGG + Intergenic
943550891 2:189338373-189338395 AGAAGCAAACAAGAGAGCTGGGG - Intergenic
944187604 2:196966773-196966795 AGGAGAAACCAGGTGTGTTGTGG - Intergenic
945146366 2:206742583-206742605 AGAAGCAAACAAGGGTGTTAGGG - Intronic
945544570 2:211135732-211135754 AGAAGCAAATAGGGGTGTTGTGG - Intergenic
945641857 2:212441413-212441435 AGAAGCAAACAGAGGTGATGGGG - Intronic
946528179 2:220542402-220542424 AGAAGCAAACAGGAATGTTGAGG + Intergenic
946727247 2:222672597-222672619 TGAAGTAAATAGGGGTGATGTGG + Intronic
946790611 2:223297312-223297334 AGAAGCAAATGGGGGTGTTGGGG - Intergenic
947136954 2:226984951-226984973 AGAAGCAAAGAGGAGGATTGGGG + Intronic
948340695 2:237248952-237248974 AGGAGCAAAGAGGGGTGGTGGGG + Intergenic
948481146 2:238251383-238251405 AGAAGCAAACAGGGAGGATGTGG + Intronic
948646657 2:239409376-239409398 AGAAGCAAACAGTGGCAATGAGG + Intergenic
948688309 2:239685623-239685645 AGAGGCACACAGGGGTGAAGTGG - Intergenic
1169894783 20:10491318-10491340 AGAAAAAAACAGGGGAGTTGAGG - Intronic
1170546738 20:17441033-17441055 AGAAGCAAACAGGGTGAGTGTGG - Intronic
1170962077 20:21034452-21034474 AGGAGCAGACAGGGCAGTTGAGG - Intergenic
1170990661 20:21299110-21299132 AGAAGCCAAGAGGGGTAATGGGG + Intergenic
1171231674 20:23491744-23491766 AGAATGAGACAGGGGTGCTGAGG + Exonic
1171296378 20:24020657-24020679 CGAAGAAAACAGGGGTGTTGGGG - Intergenic
1172814384 20:37674689-37674711 AGAAAGAAACAGGGGTGATATGG + Intergenic
1172930658 20:38584088-38584110 AGGAGCCAGCAGGAGTGTTGGGG - Intronic
1173132785 20:40410268-40410290 AAGAGCAAGGAGGGGTGTTGTGG + Intergenic
1173392588 20:42648274-42648296 AACAGCAAAAAGGGCTGTTGGGG + Intronic
1173709460 20:45141684-45141706 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1175014534 20:55775199-55775221 AGAAGCAAAGAGGAGGGTGGTGG + Intergenic
1175516703 20:59574726-59574748 AGAAGCACCCAGGGGTGATGTGG + Intergenic
1176212981 20:63934313-63934335 AAAAGCAGGCAGGGGTGCTGGGG - Exonic
1176791987 21:13328596-13328618 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1176997836 21:15577786-15577808 AGAAGCAAACAGGGGTTTTGGGG - Intergenic
1177002946 21:15635980-15636002 AAAAGCAAACAGAGGTGTTGAGG + Intergenic
1177347881 21:19897102-19897124 AGAAGCAAACTGAGATGTTTTGG - Intergenic
1177363409 21:20103413-20103435 AGAAGCAAACAGGGGCATTGGGG - Intergenic
1177437319 21:21072276-21072298 AGAAGCCAACATGGGTTATGTGG - Intronic
1177505931 21:22016952-22016974 AGAAGCAAACAGAAGGGTTGGGG + Intergenic
1177912872 21:27053790-27053812 AGAAGCAAACAAGGGTGTTGGGG - Intergenic
1177991384 21:28039602-28039624 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1178012318 21:28302475-28302497 AGAAGCAATCAGGGGTGTTGAGG - Intergenic
1178061061 21:28853587-28853609 AGAAGCAAACAGGAGTGTTGGGG + Intergenic
1178764146 21:35433372-35433394 AGAAGCAAACAGGGGTGTTAGGG + Intronic
1179828436 21:43981479-43981501 AAAAGCAGACAGGGGGGCTGGGG - Intronic
1180440067 22:15356380-15356402 AGAAGCCAGCAGTGGTGTTCTGG + Intergenic
1180441571 22:15371003-15371025 AGAAACCAACAGAGGTGTTCTGG + Intergenic
1180448219 22:15435765-15435787 AGAATCAAACAGCTGTGTTCTGG - Intergenic
1182356676 22:29725251-29725273 AGAAGCAGACAGGGAGGCTGAGG - Intronic
1182501161 22:30748606-30748628 AGAAGAAGACTGTGGTGTTGCGG + Intronic
1182965694 22:34519241-34519263 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1183574173 22:38676527-38676549 TGAAGCAAACAGGGTTAGTGTGG - Intergenic
1184603889 22:45560833-45560855 AGAGGCAAACAGGGGTGTTAGGG + Intronic
1184965905 22:47972140-47972162 AGAAGCACAAAAGGGTGCTGAGG - Intergenic
949125980 3:445592-445614 AGAAGTAAACAGGGGTGTTGGGG + Intergenic
949245549 3:1922476-1922498 AGAGGCAAACAGAGGTGTTGGGG - Intergenic
949417977 3:3833623-3833645 AGAAGCAAACAGGGGTATTAGGG + Intronic
949445297 3:4128572-4128594 AGAAGCAAACAGGGCTGTTGTGG - Intronic
949447661 3:4152438-4152460 AAAAGCAAATCCGGGTGTTGGGG - Intronic
949541794 3:5038411-5038433 AGAAGCCTGCAGGGCTGTTGTGG + Intergenic
949638466 3:6010085-6010107 AGAAGCAAATAGAGGTGTTGGGG - Intergenic
949813005 3:8027811-8027833 AAAAATAAACAGGGGTGGTGTGG + Intergenic
950192247 3:10985424-10985446 AGACACAAGCAGGGATGTTGAGG + Intergenic
951384222 3:22025322-22025344 ACAAGCAAACAGAGGTTTTGGGG - Intronic
951971068 3:28444304-28444326 AGAAGATAACATGAGTGTTGAGG + Intronic
951978407 3:28540114-28540136 AGAAGCAAAGAGGGGTTCTGGGG - Intergenic
953276287 3:41501877-41501899 AGAAGCAAACAGGAGAATGGTGG - Intronic
953556034 3:43947751-43947773 AGAAGGTATCAGTGGTGTTGCGG - Intergenic
953796442 3:45989619-45989641 ACAAGCAAAAAGGAGTGTTTGGG - Intronic
953897716 3:46814941-46814963 AGAAGCAAATGGGGGTGTTGGGG + Intergenic
954042060 3:47895993-47896015 AGAAGCAATCTGGGGTGGGGGGG + Intronic
954511949 3:51133042-51133064 ATAAGTAAACAAGGGTGTTGGGG - Intronic
954516289 3:51180509-51180531 AGAAGCAGACAGGAGTGATGTGG - Intronic
954644873 3:52125031-52125053 AGAACCAAACAGGGTGTTTGGGG - Intronic
954934403 3:54313457-54313479 TGGAGCCACCAGGGGTGTTGAGG - Intronic
956093228 3:65689936-65689958 AGAAGAAAATAGAGGTGGTGCGG - Intronic
956509323 3:69977921-69977943 AAAAGCAAACAGGGGTGTTGGGG - Intergenic
956613895 3:71152157-71152179 AGAAGCAAAGGGCTGTGTTGTGG + Intronic
957247853 3:77735772-77735794 ACAAGCAAACAGAGGTGTTGGGG + Intergenic
957634134 3:82759693-82759715 AGAAGAAAACAGGCGTGTAGAGG - Intergenic
957701328 3:83718062-83718084 AGAAGCAGACAAAGATGTTGCGG + Intergenic
957897805 3:86446310-86446332 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
958499523 3:94887706-94887728 AGAAGCAAACAGGGTATTGGGGG - Intergenic
958715407 3:97774351-97774373 AGAAGCAGGCGGGGGTATTGAGG + Intronic
958789162 3:98631019-98631041 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
959204102 3:103283223-103283245 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
959227088 3:103599734-103599756 AGAAGCAAACAGGGGTCTTGGGG + Intergenic
959377708 3:105605606-105605628 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
960349241 3:116573549-116573571 AGAAGCAAACAGGGGTCTTGGGG - Intronic
960495055 3:118363226-118363248 AGAAGCAAACAGGAATGTTGGGG + Intergenic
961177709 3:124849432-124849454 AGAAACAAACACAGGTGATGTGG - Intronic
962693103 3:137920821-137920843 TAAAGTAAAAAGGGGTGTTGTGG - Intergenic
963355982 3:144209280-144209302 AGAAGCAAACAGGGGTGTTTGGG + Intergenic
963432673 3:145229785-145229807 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
963629988 3:147720783-147720805 AGAAGCAAACAGAGGTGTTTGGG - Intergenic
963661073 3:148129694-148129716 AGAAGAAAACAGGGGTGTTGGGG - Intergenic
964977514 3:162638230-162638252 AGAAGCAAACAGGGGTATTCGGG + Intergenic
965034860 3:163424934-163424956 AGAAGAAAACAGGGGTATTGGGG + Intergenic
965191140 3:165530986-165531008 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
965251794 3:166352081-166352103 AGAAGCCAACAGGGGTGTTGGGG + Intergenic
965259896 3:166468427-166468449 AGAGGCAAAAAGGGGAGTTATGG + Intergenic
965299239 3:166989250-166989272 AGAGGCAAACAGGGGTGTTGGGG + Intergenic
965931135 3:174044173-174044195 AGGAGGAAACAATGGTGTTGTGG - Intronic
965996111 3:174884876-174884898 AGAGGTAAACAGGAGTGTTGGGG + Intronic
966044641 3:175533360-175533382 AGAAGCAAACAGGGGTGTTGGGG + Intronic
966077530 3:175956379-175956401 AGACTAAAACAGGGATGTTGAGG - Intergenic
966287614 3:178315951-178315973 AGAAGTAAGCTGAGGTGTTGTGG + Intergenic
966445354 3:179996134-179996156 AGAAGCTAACAGGGGTGTTGGGG - Intronic
966733376 3:183168811-183168833 AGGAGGAAAAAGGGGTTTTGTGG - Intergenic
966896951 3:184452332-184452354 AGAAGCAAAAAGGGGTGGTGGGG + Intronic
967831445 3:193923535-193923557 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
968572997 4:1352191-1352213 AGAAGCAAACAGTGAAGTTTTGG - Intronic
968906541 4:3455183-3455205 AGAAACAAACAGGGGTGTTAGGG - Intergenic
969609881 4:8221084-8221106 AAAAGCAAACAGGGTTGTGGAGG - Intronic
969914714 4:10478974-10478996 AGAAGCAAGCAGGGGTGGTGTGG - Intergenic
970089511 4:12388796-12388818 AGAAACAAACAGGGGTGTTAGGG + Intergenic
970166228 4:13241260-13241282 AGAAGAAGCAAGGGGTGTTGAGG - Intergenic
970287428 4:14533572-14533594 AGAAGAAAAGAGTGGTGGTGTGG + Intergenic
970497239 4:16638855-16638877 AGAAACCAACACGGGTTTTGTGG + Intronic
970577924 4:17445775-17445797 AGAAGCAAACTTGGAAGTTGGGG + Intergenic
970629212 4:17923021-17923043 AGAAGCAAACAGGGGTGTTGGGG - Intronic
970850565 4:20597757-20597779 AGAACCACACAGTGATGTTGGGG + Intronic
970876682 4:20878794-20878816 AGAGGCAAAGAGGGGCATTGTGG - Intronic
971002817 4:22341409-22341431 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
971101327 4:23468861-23468883 AGAAGCAAACAGGGGTGTTAGGG + Intergenic
971816920 4:31502621-31502643 AGAAGCAAACAAGAGTGTTGGGG - Intergenic
971832735 4:31718617-31718639 AGAAGGTAACATGGGTGTTCAGG - Intergenic
971979608 4:33735304-33735326 AGAAGCAAACAGTGGTGTTGGGG + Intergenic
972016692 4:34255114-34255136 ACAAGCAAAGAGTGGTGTAGTGG + Intergenic
972141607 4:35967633-35967655 AAAACAAAACAGGAGTGTTGAGG + Intronic
972192591 4:36612836-36612858 AGTAGCAAACAGGGGTGTTGGGG - Intergenic
972330749 4:38062632-38062654 AGAAGCACAATGGGGTGTGGGGG - Intronic
972805651 4:42527595-42527617 AGAAGCAAACAGGGGTGTTGGGG - Intronic
973118126 4:46486607-46486629 AGAAGCAAACAGGGATGTTGGGG - Intergenic
973121327 4:46523681-46523703 AGAAGCAGACAGAGGTGTTGGGG + Intergenic
974288845 4:59905022-59905044 AGAAGCAAAGAGGGGTGATAGGG + Intergenic
974458853 4:62162799-62162821 AGAAGCAAGCAGGGGTGTTGGGG - Intergenic
974479334 4:62423293-62423315 AGAAGCAAACAGGAGAGTTGGGG + Intergenic
974644930 4:64677217-64677239 CGAAGCAAACAGGGGTGTCAGGG + Intergenic
975533684 4:75426671-75426693 AGAAGCCAACAGGGAGGTTGTGG + Intergenic
975734016 4:77364449-77364471 AGAAGCAAACAGGGGTGTTGGGG + Intronic
975919091 4:79362249-79362271 GGAAGCAAACATGGGTGTGGGGG - Intergenic
976034508 4:80798191-80798213 AGAAGCAAACAGGGGTGTTGGGG + Intronic
976100212 4:81554108-81554130 AGCAGCAAAGAGGGGTGGGGAGG + Intronic
977626923 4:99197763-99197785 AGAAGCAAACGGGGGTGTTGGGG + Intergenic
977702055 4:100032324-100032346 AGAGGCAAACAGGGGTATTGGGG + Intergenic
977847374 4:101781613-101781635 AGAAGCAAAGAAGGGTGGTGGGG + Intronic
977930702 4:102745947-102745969 AGAAGCAAACAGGGGTGTTGGGG + Intronic
977962794 4:103104491-103104513 AGGAGCATAGAGGGGTGGTGGGG - Intergenic
978342153 4:107730039-107730061 AGAGGCAAACAGAGGTGTTGGGG + Intergenic
978899396 4:113929284-113929306 AGAAACAAACAGGGGTGTTGGGG + Intronic
978966529 4:114748494-114748516 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
979075411 4:116263960-116263982 AGAAGTAAACAAGGGTGTTGGGG - Intergenic
979301879 4:119095730-119095752 AGAAGCAAGTAGGGGTACTGTGG - Intergenic
979766712 4:124472358-124472380 AGAAGCAAACAGGGATATTGGGG - Intergenic
980386557 4:132092922-132092944 AGAAGCAAACAGTGGTGTTGGGG + Intergenic
980386662 4:132093908-132093930 AGAAGCAAAGAAGCCTGTTGTGG + Intergenic
980406213 4:132356250-132356272 AGAAGCAAACAGGGGCGTTGGGG + Intergenic
980497843 4:133607818-133607840 AGAAGCAAACAGGAGAGTTGGGG + Intergenic
980588733 4:134855158-134855180 GGAAGCAAACAGGAGATTTGAGG + Intergenic
980601849 4:135037040-135037062 AGAAGCAAACTAGGGTGTTGGGG - Intergenic
980692334 4:136311352-136311374 AGAAGCCAAGATGGGTGATGGGG - Intergenic
980957449 4:139443931-139443953 AGAAGCAAACAAGGGTATTGGGG - Intergenic
981462475 4:145029354-145029376 AGAAGCAAACAAGGGTGTCGGGG - Intronic
981643001 4:146967069-146967091 AGAAGGAAAAAGTGGTTTTGTGG + Intergenic
981834540 4:149040017-149040039 AGAAGCAAACAGAGGTGTTGCGG - Intergenic
982482949 4:155934088-155934110 AGAAGGAAAAAGTGGTTTTGTGG + Intronic
982526885 4:156489973-156489995 AGAAGCAAACAGGGTTGTTGTGG - Intergenic
982560509 4:156923876-156923898 AGCAGTAAACAGGGATATTGGGG + Intronic
982665107 4:158251807-158251829 AGAATCATACAAGGGGGTTGGGG - Intronic
982729730 4:158943427-158943449 AGAAGTGAGCAGGGGTCTTGAGG - Intronic
982835186 4:160114125-160114147 AGAAACAAATAGGCGTGTTGGGG - Intergenic
983184749 4:164689177-164689199 AGAAACAAACAGGGGTGCTGGGG - Intergenic
983188711 4:164730948-164730970 AGAAGAATACAGTGGTCTTGAGG + Intergenic
983581931 4:169317823-169317845 GGAAGCAAACAGGGGTGTTGGGG - Intergenic
983842190 4:172470921-172470943 ATACGCAAACCTGGGTGTTGGGG - Intronic
984400822 4:179261723-179261745 AGAAGCAAACCGGGGTGTTGGGG - Intergenic
984875497 4:184364212-184364234 AAAACCACACAGGGGTGTTCTGG - Intergenic
985226158 4:187763930-187763952 AGAAGCAAAGAGGGGTGGTAGGG + Intergenic
986037354 5:3952884-3952906 AGAAGTAAACAGGGGTGTAGTGG + Intergenic
986086799 5:4460275-4460297 AGAAACAAACAGGGATTTTGGGG - Intergenic
986111082 5:4718516-4718538 AGAAGAAAACAGCCTTGTTGAGG + Intergenic
986428067 5:7654415-7654437 AGAAGGAAACATGGATGTTGTGG + Intronic
986677812 5:10202287-10202309 AGAAACCCACAGGGGTGTTAAGG + Intergenic
986742670 5:10717662-10717684 ATTAGCAAACAGAGGTATTGGGG - Intronic
986938629 5:12921182-12921204 AGAAGCAAACAAGGGTGTTGAGG + Intergenic
986955854 5:13148579-13148601 AGAAGCCAACAGGGGTGTTGGGG + Intergenic
987063309 5:14262952-14262974 AGAAGAAAGCAGGGGTGGGGTGG - Intronic
987621515 5:20342473-20342495 AGAAGCAAACAGAGGTGTTAGGG - Intronic
987657432 5:20824076-20824098 AAAAGCAAACAGAGGTGTTGTGG + Intergenic
987686905 5:21216628-21216650 TGAAGCAAACAGGCGTGTAACGG + Intergenic
987885313 5:23805472-23805494 AGAAGCAAACAGGGGTTTTGGGG - Intergenic
987967055 5:24891042-24891064 AGAAGCAAAATGGGGTGGTACGG - Intergenic
988005382 5:25403540-25403562 AGAAGCAAAGAAGGGTGATGGGG - Intergenic
988107449 5:26770046-26770068 AGAAGCAAAAAGTGGTGTTAGGG - Intergenic
988161123 5:27519315-27519337 AGAAGCAAATAGGGTTGTTTGGG + Intergenic
988204413 5:28115583-28115605 AGAAGGAAAAAGTGGTTTTGTGG - Intergenic
988233587 5:28509523-28509545 AGAAGTAAACAGCAGTGTTGGGG + Intergenic
988561806 5:32288439-32288461 AGAAGCAAACAGGGGTGTTGGGG - Intronic
988766114 5:34379870-34379892 AAAAGCAAACAGAGGTGTTGTGG - Intergenic
988974996 5:36506570-36506592 AGAAGCTAAGAAGGGTATTGGGG + Intergenic
989045630 5:37270677-37270699 TGAAGCAAACAGAGGTGTTGGGG + Intergenic
989097455 5:37794558-37794580 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
989457963 5:41664210-41664232 AGAACCAAACAGGGGTGTTGGGG + Intergenic
989959763 5:50398073-50398095 AGAAGCAAAGAGTGGTGGTGTGG - Exonic
990604514 5:57395443-57395465 AGAAGGAAAGAGTGGTCTTGTGG - Intergenic
990760819 5:59127572-59127594 AGAAGCAAAGAGGGAAGTCGTGG - Intronic
991234542 5:64378659-64378681 AGAAACAAAAAGGGGTGTTGGGG + Intergenic
991945817 5:71897700-71897722 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
993146102 5:84095887-84095909 AGGAGGAAACAGTGGTTTTGTGG + Intronic
993232210 5:85249983-85250005 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
993319528 5:86456165-86456187 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
993791471 5:92216476-92216498 AGAAGCAAACTAGGGTGTTGGGG - Intergenic
994291701 5:98034421-98034443 AGAAGCAAACAGGGGTGCTGGGG + Intergenic
994737686 5:103575955-103575977 GGAAGCAAACAGGGGAGTGACGG - Intergenic
994958148 5:106561894-106561916 AGAAGTAAACAGGGGTGGTGGGG - Intergenic
994984730 5:106918166-106918188 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
995269869 5:110207909-110207931 AGAAGCAAACAGGAATGTTGGGG + Intergenic
995279386 5:110316341-110316363 AGAAGTAAACAGGGGTGCTGGGG + Intronic
995428057 5:112046216-112046238 AAAAGCAAACAGGGGTGTGGGGG + Intergenic
995983286 5:118134914-118134936 ATAAGTAAACATGAGTGTTGAGG - Intergenic
996165264 5:120214971-120214993 AGAAGCAGACAGGGGTATTGGGG + Intergenic
996266251 5:121544142-121544164 AGAAGCAAACAGGGGTGTTGAGG - Intergenic
996386797 5:122917291-122917313 AGAAGCAAGGAGAGATGTTGAGG - Intronic
996825243 5:127675375-127675397 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
996909014 5:128634470-128634492 AGAAGCAAAGAGGGGTGGTGGGG + Intronic
997270736 5:132535611-132535633 TGAGGCAATAAGGGGTGTTGAGG - Intergenic
998290660 5:140911032-140911054 AGAAGCAAACAGGGGTGGTGGGG + Intronic
1000223607 5:159237040-159237062 GGAAGCAAACAGGGGTGTTAGGG + Intergenic
1000423171 5:161060588-161060610 AGAAGCAAAAAGGGGTGGTGGGG + Intergenic
1000462849 5:161544709-161544731 AGCAGCAAACAATGGAGTTGGGG + Intronic
1000646493 5:163766256-163766278 AGAAGAAAACAGTTTTGTTGAGG + Intergenic
1000730462 5:164828517-164828539 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1001135869 5:169102177-169102199 AAAAGGAAACATGTGTGTTGGGG + Intronic
1001680414 5:173552972-173552994 AGAAGCACACAGGGTTGGAGGGG + Intergenic
1003696226 6:8408539-8408561 AGAAGCAAACAGGGGTATTGGGG + Intergenic
1003758281 6:9147603-9147625 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1004483524 6:16043778-16043800 AGAGGCAAAGAGGGCTGCTGGGG + Intergenic
1004622330 6:17342019-17342041 AGAAGCAAAAAAGGGTGGTGGGG - Intergenic
1004824617 6:19405670-19405692 AGAAGCAAACAGGAGTATTGGGG + Intergenic
1004989461 6:21120540-21120562 AGAAGAAAACAGGGGTCTCTAGG - Intronic
1004994278 6:21173119-21173141 AGGAGGAAAGAAGGGTGTTGTGG - Intronic
1005622786 6:27635436-27635458 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1006054813 6:31376387-31376409 GGAATCACAGAGGGGTGTTGGGG + Intergenic
1006062027 6:31430715-31430737 AGAAGCAAACAGAGGTGTTAGGG - Intergenic
1006117928 6:31785160-31785182 AGGAGAAAGCAGAGGTGTTGTGG - Intronic
1007643311 6:43361183-43361205 AGAAGCAAACAGCTTTCTTGGGG - Intronic
1008079679 6:47180799-47180821 AGAAGCAAACAGGGTTGTTGGGG + Intergenic
1008399966 6:51053040-51053062 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1009263731 6:61528092-61528114 AGAAAGAAAGAAGGGTGTTGGGG - Intergenic
1009308328 6:62119860-62119882 AGAAGCAAACAGGGGTGTTGGGG - Intronic
1009390420 6:63137499-63137521 AGAAGAAAACAGGAACGTTGGGG + Intergenic
1009806163 6:68604372-68604394 AGAAGCAAACAGGGCTGTTGGGG - Intergenic
1009874913 6:69493787-69493809 AGAAACAAACAGGGGTGGCAGGG + Intergenic
1010280291 6:74015497-74015519 AGAAGGAAACAAGGATGCTGGGG - Intergenic
1010323258 6:74538028-74538050 AGAAGCAGACAGGGATGTTGGGG - Intergenic
1010325632 6:74559039-74559061 AGAAGCAAATAGGGATGTTTGGG + Intergenic
1010552117 6:77236279-77236301 AGAAGCAGACAGGGGTGTTGAGG - Intergenic
1010581038 6:77596188-77596210 AGAAGCAAGCAGGGGTGTTGGGG + Intergenic
1010818275 6:80385665-80385687 AGAAGCAAATAGAGGTGTAGAGG - Intergenic
1010938470 6:81888147-81888169 AGAAGCAAACAGGGGTATTGGGG + Intergenic
1011039676 6:83015701-83015723 AGAAGCAAACAGAGGTATTGGGG + Intronic
1011068775 6:83359252-83359274 AGAAGCAAACAGAGGTGTTGGGG - Intronic
1011575814 6:88797797-88797819 AGAAGGAGAAAGGGGTGTGGAGG + Intronic
1012730151 6:102871894-102871916 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1012820489 6:104080489-104080511 AGAAGCAAACAGAGGTATTGGGG - Intergenic
1012921114 6:105221920-105221942 AGAAGCAAACAGGAGTATTGGGG + Intergenic
1013120955 6:107140052-107140074 AGAAGCAAAGAGGATTGTTAAGG + Intergenic
1013364303 6:109424201-109424223 AGAAACAGACAGTGGGGTTGGGG + Intronic
1013567256 6:111379517-111379539 AGAAGCAAACACTGGTGTTGTGG - Intronic
1014456163 6:121637048-121637070 AGAAGCAAACAGAGGTGTTGAGG + Intergenic
1014534524 6:122599079-122599101 GGAAGCAAACAGAGGTGTTGGGG + Intronic
1014539006 6:122651388-122651410 AGAAGCAAAGAGGGGTGTCAGGG + Intronic
1014910938 6:127092145-127092167 ATGAGCAAACAGGAGTGATGGGG - Intergenic
1014969935 6:127801768-127801790 AGAAGCACACAGGGGTGTTGGGG - Intronic
1015475416 6:133654879-133654901 AGAAGCAAACCGGGGTGTTGCGG - Intergenic
1016143972 6:140646962-140646984 AGAAGCAAACAAGGATGTCAGGG - Intergenic
1016147616 6:140695157-140695179 AGGTGCAAACAGGGGTGTTGGGG + Intergenic
1016219888 6:141655167-141655189 AGAAACAAACATAGGTGTTGGGG - Intergenic
1016576567 6:145575038-145575060 AGAAGCAGACAGAGCTGTTGGGG + Intronic
1017044454 6:150334217-150334239 AGAAGCAAACAGGGGTGAGGGGG + Intergenic
1017228139 6:152043534-152043556 ATAAGCAAACAGGGGTATTGAGG + Intronic
1017942215 6:159062956-159062978 TGAAGCAAATAGGGAGGTTGTGG + Intergenic
1017977431 6:159370487-159370509 AGAAGCAAACAGGGCCATTGTGG + Intergenic
1018535310 6:164812915-164812937 ATAAGCAAATAGGTGTGTTGAGG + Intergenic
1018569647 6:165195629-165195651 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1020153216 7:5700040-5700062 AGTAGCAAAGAGGAGTGTTTAGG - Intronic
1020306034 7:6835572-6835594 AGAAGTACACGGGGGTGTGGAGG + Intergenic
1020710004 7:11595173-11595195 AGAAGCAAACAGGGGTGTTGGGG - Intronic
1022044377 7:26611546-26611568 AGAGGCCAACAGGGGTGATTGGG - Intergenic
1022078572 7:26997898-26997920 AGAAATAAACAGGGGTGTTGGGG - Intergenic
1022639163 7:32165152-32165174 AGGATCAAACATGGGTTTTGTGG - Intronic
1022678351 7:32521799-32521821 AGAAGGAAAAAGTGGTTTTGTGG + Intronic
1024009395 7:45254805-45254827 AGAAGCAAAAAGGGGTGTTGGGG + Intergenic
1024040196 7:45547124-45547146 AGAAGCAAGCAGGGGTGTTGGGG + Intergenic
1024884669 7:54127087-54127109 AGAAACAAACAGGGGCATTGGGG + Intergenic
1024958579 7:54951524-54951546 ATAAGCAAACAGATGTATTGGGG + Intergenic
1025090800 7:56062460-56062482 AGAAGAAGAGAGGGGTGTTCAGG + Intronic
1025833272 7:65073225-65073247 AGAAGGAGAGAGGGGTGTTCAGG + Intergenic
1025903034 7:65762731-65762753 AGAAGGAGAGAGGGGTGTTCAGG + Intergenic
1026611168 7:71861150-71861172 TAAAGCAAACTGGTGTGTTGTGG + Intronic
1028141424 7:87279538-87279560 AAGAGCAAACAGAGGTGCTGGGG - Intergenic
1029590549 7:101504093-101504115 AGAAAAAAAAAGAGGTGTTGGGG - Intronic
1029804597 7:102983120-102983142 AGAAGCAAAGAGGGGTGGTAGGG + Intronic
1030277134 7:107733665-107733687 AGAAGCAAAGAGAGGTGTTGGGG - Intergenic
1030368231 7:108670513-108670535 AAAAGCAAACAGGGGTATTGGGG - Intergenic
1030820956 7:114090055-114090077 AAAAACAAACAAGGGTGATGAGG - Intronic
1031236535 7:119185559-119185581 AGAAGCAAACAGGGGTGTAGTGG - Intergenic
1031474756 7:122207784-122207806 AGAAGAAAACAGAGGTGTTGGGG + Intergenic
1031676253 7:124615898-124615920 AGATGCAAACAAGGGCCTTGGGG - Intergenic
1031779437 7:125942689-125942711 AGAAGTAAACAGGGGTGCTCGGG + Intergenic
1032153438 7:129449378-129449400 AGAACCAAACAAAGGTGTTGAGG + Intronic
1032478737 7:132229783-132229805 GGAAGCAGACAGGTGTGGTGTGG + Intronic
1033075891 7:138250265-138250287 AGAAGAAAACTGGGGTGTTGGGG - Intergenic
1033847201 7:145448083-145448105 AGAAGAAAACAGGTGGATTGAGG - Intergenic
1034169620 7:149052925-149052947 AGAAGCAAACACGGGTGTTGGGG - Intergenic
1034901169 7:154908880-154908902 AGAAGCAGAGAGGAGGGTTGGGG - Intergenic
1035677990 8:1468429-1468451 AGAAGAAACCATGGCTGTTGGGG - Intergenic
1036072486 8:5456631-5456653 AGAGGCAAACAGGCTAGTTGAGG + Intergenic
1036166475 8:6438850-6438872 AGAAGGAAAACGGGGTGTGGGGG + Intronic
1036691466 8:10947393-10947415 AGATGCAGACAGTGGAGTTGAGG + Intronic
1037320184 8:17634089-17634111 AGAAGCCAAGATGGTTGTTGAGG - Exonic
1037350091 8:17943793-17943815 AGGAGGAAACAGGGGTGGGGTGG - Intronic
1037628676 8:20632142-20632164 AGCAGCAACCAGGGGTGGGGTGG - Intergenic
1037801170 8:22036777-22036799 TGAATGCAACAGGGGTGTTGCGG + Exonic
1038200041 8:25403477-25403499 ACAAGCAAACAGGGCAGCTGTGG + Intronic
1038266013 8:26040544-26040566 AGAAACAAACTGGGGGGTTTGGG + Intronic
1038627297 8:29206610-29206632 AGAAGGAAAAAGGGAGGTTGGGG - Intronic
1038790802 8:30666488-30666510 AGAAGCAAAGAAAGGTGATGAGG + Intergenic
1039330301 8:36530424-36530446 AGAAGAAAACAAGAGTGTTGGGG - Intergenic
1040286875 8:46104995-46105017 AGAAGCCACCAGGGCTGTCGTGG - Intergenic
1040335507 8:46413960-46413982 AGAAGCCACCAGGGCTGTTCTGG + Intergenic
1040916461 8:52570279-52570301 GGAAACAAACAGGAGTGTTGGGG + Intergenic
1041810449 8:61902721-61902743 GGAAGCAAAAAGTGATGTTGGGG - Intergenic
1041985870 8:63922041-63922063 AGAAGCAAATAGGGGTGTTGGGG - Intergenic
1042001378 8:64126414-64126436 AGAAGCAAACAGGGCTGTTGGGG + Intergenic
1042067940 8:64899538-64899560 AGAAGAAAAAAGGGGTGCTGTGG - Intergenic
1042830240 8:73018866-73018888 AAAAGCTAATAGGGTTGTTGAGG + Intronic
1043257694 8:78156941-78156963 AAAAGCAAACAGGGGTGTTGTGG - Intergenic
1043519580 8:81029836-81029858 AGAAGAAAGCAGTGCTGTTGGGG - Intronic
1043744301 8:83854510-83854532 AGAAGTAAAGAAGGGTATTGTGG + Intergenic
1044150491 8:88770678-88770700 AGAAGCAAACAAGGGTGTTGGGG - Intergenic
1044286290 8:90414893-90414915 AGAAGCAAACAGGGGTGGTGGGG + Intergenic
1044487477 8:92769594-92769616 AGAAGCAAACAAAGGTGTTGGGG + Intergenic
1044633749 8:94302254-94302276 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1044943683 8:97369951-97369973 AGAGGAAAAAAAGGGTGTTGGGG - Intergenic
1045001114 8:97879084-97879106 AGAAGCAAACAGAGGTGACAAGG + Intronic
1045221444 8:100204216-100204238 AGAAGCAAACAAGGTTGTTGGGG - Intronic
1046052932 8:109044879-109044901 AGAAGGAAAAAGTGGTTTTGTGG - Intergenic
1046190171 8:110784832-110784854 AGAAGCAGGGAGGGGTGTGGAGG + Intergenic
1046197248 8:110881805-110881827 AGAAGAAAACAGAGGTGTTGGGG - Intergenic
1046586096 8:116150071-116150093 AGAAGCAAACAGAGATGTTGGGG + Intergenic
1048084202 8:131159593-131159615 AGAAGCAAACAGGGGTGTTGAGG + Intergenic
1048654670 8:136522668-136522690 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1048969678 8:139638526-139638548 AGCAGGAAACAGGGCTGGTGAGG + Intronic
1050487454 9:6149130-6149152 AGAAGCAAAGAGGGATGATGGGG + Intergenic
1051339902 9:16101694-16101716 AGGAGCAAACTGCTGTGTTGTGG + Intergenic
1052101272 9:24448706-24448728 AGAAGCAAAGAGGCATGATGGGG + Intergenic
1052218102 9:25990573-25990595 AGGAGGAAACAGTGGTTTTGTGG - Intergenic
1052227293 9:26105929-26105951 AGAAGCAAACAGAGGTCTTAGGG - Intronic
1052368314 9:27638388-27638410 AGGAGCAAACAGGGGTGTTGGGG - Intergenic
1052718478 9:32146675-32146697 AGAGGCAAACAGGGGTGTTGGGG - Intergenic
1053717210 9:40908833-40908855 AGAAACAAGCAGCGGTGTTCTGG - Intergenic
1055205322 9:73722809-73722831 AGAAGCAAAGAGGGGTGTTGGGG - Intergenic
1056011364 9:82334158-82334180 AGAAGCAAACAGGCCTCTTGAGG - Intergenic
1056185051 9:84126189-84126211 AGAAGCAAACGGTCCTGTTGTGG + Intergenic
1056314559 9:85375393-85375415 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1056647714 9:88429353-88429375 AGAAGCAAGCAGCGGTCTTATGG - Intronic
1056787683 9:89604686-89604708 ATAAGCAAACAAGGTTTTTGTGG + Intergenic
1057169019 9:92949774-92949796 ACACTCGAACAGGGGTGTTGTGG - Intronic
1057316261 9:93970688-93970710 GGAAGCAAACAGGGATGTTGGGG - Intergenic
1058259558 9:102812118-102812140 AGAAGAAAACAAAGGTGTTGGGG + Intergenic
1059173605 9:112149322-112149344 AGAAGCCCCCGGGGGTGTTGTGG + Exonic
1060693221 9:125683452-125683474 AGAAGCAAACAGCTATGTTATGG + Intronic
1060805695 9:126574796-126574818 AGAAGCAAAGAGGGGTAGTGGGG + Intergenic
1061466441 9:130784427-130784449 AGAAGCAAAGAGTGGTATTTTGG + Intronic
1061646995 9:132011672-132011694 AGAAACAAAAAGGGGAGTTGGGG + Intronic
1062170226 9:135130810-135130832 AGAAGCAAACTGAGGTCTGGAGG + Intergenic
1062206453 9:135340162-135340184 AGGAGCAAACAGGGACGTGGTGG - Intergenic
1203440277 Un_GL000219v1:1079-1101 AGAACCAAACAGGAGTGTTCTGG + Intergenic
1203457101 Un_GL000219v1:178552-178574 AGAACCAAGCAGCGGTGTTCTGG + Intergenic
1203492983 Un_GL000224v1:124311-124333 AGAACACAACAGGAGTGTTGTGG - Intergenic
1203493115 Un_GL000224v1:125460-125482 AGAAGACAGCAGGAGTGTTGTGG - Intergenic
1203494779 Un_GL000224v1:140820-140842 AGAAGAAAGCAGGTGTGTTCTGG - Intergenic
1203495111 Un_GL000224v1:143843-143865 AGAAGCCAACAGCAGTGTTCTGG - Intergenic
1203496854 Un_GL000224v1:159895-159917 AGAACAAAGCAGGAGTGTTGTGG + Intergenic
1203498628 Un_GL000224v1:177222-177244 AGAACCAAACAGGAGTGTTCTGG + Intergenic
1203505604 Un_KI270741v1:66182-66204 AGAACACAACAGGAGTGTTGTGG - Intergenic
1203505735 Un_KI270741v1:67335-67357 AGAAGACAGCAGGAGTGTTGTGG - Intergenic
1203507398 Un_KI270741v1:82695-82717 AGAAGAAAGCAGGTGTGTTCTGG - Intergenic
1203507737 Un_KI270741v1:85766-85788 AGAAGCCAACAGCAGTGTTCTGG - Intergenic
1203509478 Un_KI270741v1:101817-101839 AGAACAAAGCAGGAGTGTTGTGG + Intergenic
1203511163 Un_KI270741v1:119510-119532 AGAACCAAACAGGAGTGTTCTGG + Intergenic
1185531202 X:820501-820523 AGAGGCACACAGGGAGGTTGTGG + Intergenic
1185609021 X:1383316-1383338 AAAAACAAACAGGGGTGGTGGGG - Intergenic
1186124230 X:6395636-6395658 AGAAGCAGCCAGGCGTGGTGGGG + Intergenic
1186279316 X:7975711-7975733 AGAAGCAAACAGGGGTGTTAGGG - Intergenic
1186470111 X:9814527-9814549 AGAAGCAAACAGGGGTGTCGGGG + Intronic
1187022456 X:15398385-15398407 ATAAGAGAACAGGGGTGATGGGG + Intronic
1187260933 X:17684581-17684603 AGAAGCAAACTGTCGTGTTGTGG - Intronic
1188597710 X:31921869-31921891 AAAAGTAAACAGGAGTGATGAGG - Intronic
1189271196 X:39753235-39753257 AGAACCAAACCAGGGTGCTGTGG + Intergenic
1189630025 X:42942998-42943020 AGAAGCAAAGAGAGGTGGTGGGG + Intergenic
1190119572 X:47649468-47649490 GCAAGCATACAGGGGTGTGGGGG + Intronic
1191096630 X:56679961-56679983 AGAAGCAAACAGGGGTATTGGGG + Intergenic
1191169750 X:57431250-57431272 AGAAGCAAAGAAGGGTGGTATGG + Intronic
1191659128 X:63632436-63632458 AGAAGCAAACAGGGATGTTGTGG + Intergenic
1191719559 X:64218107-64218129 AGAAGCAAACAGCGGTGTTGCGG + Intergenic
1191759047 X:64627463-64627485 AGAAGCAAACAGAGGTTTTGGGG - Intergenic
1192154590 X:68734484-68734506 AGAAACAGACTGGGGTGTAGTGG - Intergenic
1192298035 X:69870437-69870459 AGAGGCAAACAGAGATGTTGGGG + Intronic
1192661878 X:73050206-73050228 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1192673558 X:73170826-73170848 AGAAGCAAACAGGGGAGTTGAGG + Intergenic
1192940788 X:75909672-75909694 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1193053118 X:77122731-77122753 AGAAGCAAACAGGGATGATGGGG - Intergenic
1193155957 X:78174468-78174490 AGAAGCAAACAGGGATGTTGGGG + Intergenic
1193187146 X:78526984-78527006 AGAAGCAAAAAGGGGTAATGGGG - Intergenic
1193297479 X:79850250-79850272 AGAAGCAAACATGGGTGTAGGGG - Intergenic
1193433203 X:81437866-81437888 AGAAGCAAAAAAGGGTGTTGAGG + Intergenic
1193531594 X:82660857-82660879 ATAAGCAAAGAGGGATGGTGGGG + Intergenic
1193753583 X:85378785-85378807 AGAAGCAAACAGGTTTTTTTTGG - Intronic
1193832627 X:86307671-86307693 AGAAGCAAACAGAGGTGTTGGGG - Intronic
1193869620 X:86780797-86780819 AGAAGCAAACAGGCTTGTTGGGG + Intronic
1193876972 X:86872853-86872875 AGAAGCAAACAGGGTTGTTGGGG - Intergenic
1193904284 X:87224109-87224131 AGAAGCAAACAGAGGTTTTAGGG - Intergenic
1193978935 X:88157763-88157785 AGGAGGCAACAGGGGTGTTGAGG - Intergenic
1194032316 X:88832304-88832326 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1194087804 X:89550750-89550772 AGAAGTAAAGAGTAGTGTTGAGG - Intergenic
1194179901 X:90698405-90698427 AGAAGCACACAAGGGTGTTCGGG + Intergenic
1194297349 X:92143370-92143392 AGAAGGAAAAAGTGGTTTTGTGG + Intronic
1194343001 X:92728661-92728683 AGATGCAAACAGGGGTGTTGGGG - Intergenic
1194513719 X:94824689-94824711 AGAAGTAAACAAGGGTATTGTGG + Intergenic
1194520823 X:94916986-94917008 AGAAGTAAAGAGAGGTGTTGAGG - Intergenic
1194604713 X:95964433-95964455 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1194771541 X:97912800-97912822 AAAAGCAAACATTGGTGTTTGGG + Intergenic
1194833620 X:98656354-98656376 AGAAGCAAACAGGGGTGTTGGGG - Intergenic
1195070353 X:101273219-101273241 AGAAGCAAAGAGGCTGGTTGGGG - Intronic
1195259467 X:103117837-103117859 GGAAGCAAACACTGGTGTTATGG + Intergenic
1195749171 X:108147124-108147146 GGAAGCAAACAGGGGTGTTGGGG + Intronic
1195782689 X:108482319-108482341 AGAAGCAAATGGAGGTGTTGGGG + Intronic
1195809980 X:108818276-108818298 GGAAGCAAACAGGGTTGTTGGGG + Intergenic
1195900612 X:109793821-109793843 AGAGGCAAACATGAGTGCTGTGG - Intergenic
1196124259 X:112082575-112082597 AAAAGCAAAGAGGGGTGGGGAGG + Exonic
1196275505 X:113761669-113761691 GAAAGCAAACAGGGGTGTTGGGG - Intergenic
1197001985 X:121450603-121450625 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1197044145 X:121975998-121976020 AGAAGCAAACGGGGGTGTTGGGG - Intergenic
1197074368 X:122337347-122337369 AGAAGCAAACAGGGGTGTTGGGG + Intergenic
1197084507 X:122455950-122455972 AGAAGCAAACAAGGGTGTTGGGG + Intergenic
1197097155 X:122610393-122610415 GGAAGCAAACTGGGCTGTTGGGG - Intergenic
1197245424 X:124161764-124161786 AGAAGCAAATAGGGGTGTTGGGG + Intronic
1197387120 X:125815121-125815143 GGAAGCAAACAGAGGTGTTGGGG + Intergenic
1197404776 X:126036740-126036762 AGAAGCAAACAGAGATGTTGGGG - Intergenic
1197409533 X:126098280-126098302 GGAATCAAACAGGGGTTTTGTGG + Intergenic
1197426051 X:126298060-126298082 AGAATCAAACAGGGGTATTGAGG + Intergenic
1197477677 X:126943775-126943797 AAAAGCAAACAGGGGTGTTGGGG + Intergenic
1197537315 X:127706819-127706841 AGAAGCAAAGAGGGGTGGTGGGG - Intergenic
1197554583 X:127937999-127938021 AGAAGCAAACAGGGATGTTGGGG + Intergenic
1197591542 X:128416898-128416920 AGAAGCAAACAGAGGTGTTCGGG - Intergenic
1197887984 X:131238130-131238152 AGAAGCAAACAGGGGAGCCAGGG - Intergenic
1197956235 X:131951426-131951448 AGAAGAAAACAGGAGTGTCGGGG - Intergenic
1198169725 X:134093817-134093839 AGAAGCAAAGAAGGGTGGTGGGG - Intergenic
1198209929 X:134507257-134507279 AGAACCAAGCAGGGTTGGTGGGG + Intronic
1198651091 X:138864535-138864557 AGAAGCAAAAAGGGGAGGTTGGG + Intronic
1198700927 X:139397451-139397473 AGAAGTAAACAGGGGTGTTGAGG - Intergenic
1198783355 X:140260243-140260265 AGAAGCAAACAGCGGTGTTGGGG + Intergenic
1199539085 X:148938225-148938247 AGAAGCAATCAGAGGTATTCAGG - Intronic
1199627398 X:149753043-149753065 AGAAGTAAAAAGGGGTGTTGGGG + Intergenic
1200103330 X:153699329-153699351 AGAAGCCATCAGGGCTGGTGAGG + Intergenic
1200340612 X:155391534-155391556 AGAAGCAAACAGGGGTATTAGGG + Intergenic
1200440818 Y:3210053-3210075 AGAAGTAAAGAGTAGTGTTGAGG + Intergenic
1200520981 Y:4209597-4209619 AGAAGCAAACAGGGGTGTTTGGG - Intergenic
1200526557 Y:4280574-4280596 AGAAGCACACAAGGGTGTTCGGG + Intergenic
1200651362 Y:5845327-5845349 AGATGCAAACAGGGGTGTTGGGG - Intergenic
1200973367 Y:9180000-9180022 AGAAACAAACAGAGGTGTTGGGG + Intergenic
1200975457 Y:9207807-9207829 AGAAGTAAACAGAGGTGTCAGGG - Intergenic
1201295885 Y:12462893-12462915 AGAAGCACCCAGAGGTGTGGAGG - Intergenic
1201529931 Y:14980459-14980481 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1201798161 Y:17924263-17924285 AGAACCAAACAGAGATGTTGGGG - Intergenic
1201803392 Y:17981694-17981716 AGAACCAAACAGAGATGTTGGGG + Intergenic
1202100137 Y:21298989-21299011 AGAAGCAAACAGGGGTGTTCAGG - Intergenic
1202135697 Y:21658722-21658744 AGAAGTAAACAGAGGTGTAAGGG + Intergenic
1202137709 Y:21684512-21684534 AGAAACAAATGGAGGTGTTGGGG - Intergenic
1202341365 Y:23872355-23872377 AGAAAAAAACAGAGGTGTTCGGG + Intergenic
1202359486 Y:24092954-24092976 AGAACCAAACAGAGATGTTGGGG - Intergenic
1202511292 Y:25577160-25577182 AGAACCAAACAGAGATGTTGGGG + Intergenic
1202529401 Y:25797731-25797753 AGAAAAAAACAGAGGTGTTCGGG - Intergenic