ID: 1177991385

View in Genome Browser
Species Human (GRCh38)
Location 21:28039603-28039625
Sequence GAAGCAAACAGGGGTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 72, 1: 124, 2: 116, 3: 85, 4: 338}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991375_1177991385 9 Left 1177991375 21:28039571-28039593 CCAACTGGGACTTTAGACTAGTT No data
Right 1177991385 21:28039603-28039625 GAAGCAAACAGGGGTGTTGGGGG 0: 72
1: 124
2: 116
3: 85
4: 338
1177991374_1177991385 21 Left 1177991374 21:28039559-28039581 CCTTAGGGGGGGCCAACTGGGAC No data
Right 1177991385 21:28039603-28039625 GAAGCAAACAGGGGTGTTGGGGG 0: 72
1: 124
2: 116
3: 85
4: 338
1177991373_1177991385 22 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991385 21:28039603-28039625 GAAGCAAACAGGGGTGTTGGGGG 0: 72
1: 124
2: 116
3: 85
4: 338
1177991369_1177991385 26 Left 1177991369 21:28039554-28039576 CCTCCCCTTAGGGGGGGCCAACT No data
Right 1177991385 21:28039603-28039625 GAAGCAAACAGGGGTGTTGGGGG 0: 72
1: 124
2: 116
3: 85
4: 338
1177991371_1177991385 23 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991385 21:28039603-28039625 GAAGCAAACAGGGGTGTTGGGGG 0: 72
1: 124
2: 116
3: 85
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991385 Original CRISPR GAAGCAAACAGGGGTGTTGG GGG Intergenic
900406145 1:2493896-2493918 GGAGCATCCAGGGGTGTGGGAGG + Intronic
900532029 1:3159157-3159179 GAAGCAGACAGGGAGGCTGGAGG + Intronic
901125957 1:6928818-6928840 GGAGCAAACAGAGGAGCTGGGGG - Intronic
901239645 1:7685558-7685580 GGAGCAAGCAGGGGAGTGGGAGG - Intronic
901269665 1:7942186-7942208 GAAGGAAAAAGGGGTGTTTCTGG + Intronic
901904395 1:12395083-12395105 GAAGCAAACAGGGGTGTTGGGGG + Intronic
902652972 1:17848693-17848715 GAAGGAAGCAGGGGGGTGGGTGG - Intergenic
904214160 1:28906273-28906295 TAAGGAAGCAGGGGTATTGGGGG - Intronic
904335592 1:29795556-29795578 GAAGCAAACGGGGGCATTGGAGG - Intergenic
904407131 1:30299679-30299701 GAAGCAAGCAGGCTTCTTGGTGG + Intergenic
905353751 1:37366358-37366380 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
905464891 1:38145682-38145704 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
905891603 1:41521750-41521772 GAGGCAGGCAGGGTTGTTGGTGG - Intronic
906465446 1:46074538-46074560 GAAGCAAAGAGGTGTGGTGGGGG + Intronic
906686374 1:47765929-47765951 GAAGCAGACAGCGATGGTGGTGG + Exonic
907467807 1:54651086-54651108 GAACCACACAGTGGTGGTGGGGG - Intronic
907487772 1:54789163-54789185 GAAGCAAGCATGGGCTTTGGAGG - Intronic
907603179 1:55790282-55790304 AAAGCAAAGAGGGGTATTGGTGG + Intergenic
907780014 1:57558356-57558378 GAAGCAAACAGGGATGTTGTGGG - Intronic
907981272 1:59483899-59483921 GAAGGAAGCAGGGGTCTTGAAGG + Intronic
908616568 1:65929134-65929156 GAAGCAAACAGGCAGGTTGGGGG + Intronic
909172926 1:72317872-72317894 AACGCAAACAGGGGTGTTGGGGG + Intergenic
909576586 1:77183450-77183472 AAAGCAAACAGGGGTGTTGGAGG - Intronic
909693360 1:78435953-78435975 GAACAAAACAGGGGTGAAGGAGG + Intronic
909810693 1:79929150-79929172 GAAGCAAACAGGTGTGTTGTGGG - Intergenic
910561535 1:88597266-88597288 GAAGCAAATAGGAGTATTGGGGG - Intergenic
910587883 1:88899312-88899334 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
910790006 1:91041424-91041446 AAAGCAAACAGGGGTATTGGGGG - Intergenic
910831478 1:91466132-91466154 GAAGCAAACTCGGGTGTTGAGGG + Intergenic
911092943 1:94031990-94032012 GACCCAAGCAGGGGTGTCGGGGG + Exonic
911883252 1:103268054-103268076 GAAGCAAATAGGGGTGTTGGGGG - Intergenic
911980151 1:104557249-104557271 GAAGGAAACAGGGGTGTTGGGGG - Intergenic
912130225 1:106590476-106590498 AAAGCAAACAGGGGTGTTGGAGG + Intergenic
912252156 1:108022228-108022250 GAAGCAAACAGGGATGTTGGGGG + Intergenic
912411432 1:109483390-109483412 GAAGGACACAGGGGTGGTGTGGG - Intergenic
912733647 1:112131242-112131264 AAAGCAAATAGGGGTGTTGGGGG + Intergenic
912944144 1:114070592-114070614 GAAGGAAACAGGGGTGTTGGGGG + Intergenic
914247054 1:145893983-145894005 GAAGTAAACACCAGTGTTGGTGG - Intronic
915476548 1:156155964-156155986 GAAGAAAGCAGGGGTGGTTGGGG + Intronic
915667989 1:157462072-157462094 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
916200928 1:162271173-162271195 GGATCATACTGGGGTGTTGGGGG - Intronic
916752365 1:167734683-167734705 GAAGCAAAGAGAGGCGTTGGGGG + Intronic
917217540 1:172693324-172693346 GAAGCAAACAGGGGATTTGGGGG + Intergenic
917282879 1:173396044-173396066 GAAGCAAAGAGAGGTGGTGAGGG - Intergenic
917311890 1:173687457-173687479 GAAGAAAAAAGGGGTGGGGGGGG - Intergenic
917462405 1:175243797-175243819 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
917995146 1:180430219-180430241 GAAGCAAATACAGGTTTTGGTGG - Exonic
918756033 1:188340214-188340236 GAAGAAAACAGGAGTGTTGGGGG + Intergenic
918957951 1:191235608-191235630 GAAGCAAAGAGAGGTGTTGGGGG - Intergenic
919124973 1:193382563-193382585 GAAGCAATAAGGGGTGTTGGGGG + Intergenic
919230325 1:194764978-194765000 GAAGCAATCAGGTGTGTTTGGGG + Intergenic
919241487 1:194922082-194922104 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
919688039 1:200502743-200502765 GGAGGAAGCAGGAGTGTTGGGGG - Intergenic
920197100 1:204235946-204235968 GAAGCAAACAGAGGTGTTGGGGG - Intronic
920732770 1:208503389-208503411 GGAGCAAGGAGGGGAGTTGGTGG + Intergenic
922610624 1:226924450-226924472 GAAGCCCATAGGGGGGTTGGGGG - Intronic
922643591 1:227261840-227261862 GAAGCAACCTAGGGTGTTGGTGG + Intronic
923291550 1:232551130-232551152 GAAGCAAACAGTAGGGCTGGTGG + Intronic
924841066 1:247709964-247709986 GAAGTAAACAGAGGCATTGGGGG + Intergenic
1062770806 10:99097-99119 GAAGCAAACAAGGGTGTTGCAGG + Intergenic
1062815561 10:497395-497417 GAAGTAATGAGGGGTGTGGGAGG - Intronic
1063603876 10:7506344-7506366 GAGGAAAGCTGGGGTGTTGGGGG + Intergenic
1063702001 10:8394021-8394043 GAAGCAAAAAAGGCTCTTGGAGG - Intergenic
1064517974 10:16170654-16170676 GAAGCAAACAGGGGTGTTAGGGG + Intergenic
1064790752 10:18955543-18955565 AAATTAACCAGGGGTGTTGGTGG - Intergenic
1065876509 10:30001789-30001811 CATGCCAACATGGGTGTTGGGGG + Intergenic
1066169404 10:32826137-32826159 GAAGCAAACAGGGATGTTGGAGG - Intronic
1066251206 10:33634447-33634469 GAAGCACCCAGGAGTGTTTGGGG + Intergenic
1066528841 10:36313856-36313878 GAAGCAAACAGAGTGGGTGGGGG - Intergenic
1067332829 10:45337798-45337820 GAAGCAGACAGGGGTGTTGGGGG - Intergenic
1067661690 10:48240910-48240932 AAAGCACACAGAGATGTTGGGGG - Intronic
1068423951 10:56831993-56832015 TAAGCAAAGAGGAGTGTAGGAGG - Intergenic
1068446891 10:57136164-57136186 GAAGCAAACGGGGGTGTTGAGGG - Intergenic
1068519089 10:58059622-58059644 GAAGCAAAAAGTGGTTTTGTAGG + Intergenic
1068648164 10:59492688-59492710 GCAGCAACCAGTGGTGGTGGTGG - Intergenic
1068837562 10:61571013-61571035 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1069192631 10:65508774-65508796 GAAGCAAACAGGAGTGTTAGAGG + Intergenic
1069608743 10:69758041-69758063 CAGGCAGACAGGGGTGCTGGTGG - Intergenic
1069728477 10:70596263-70596285 GAAACAAACATGGGGGTGGGCGG - Intergenic
1069826928 10:71260273-71260295 GAGGCAAGCAGGGGTGCTCGGGG + Intronic
1070051652 10:72895532-72895554 GAAGCAAAGTGGGGTGATGAGGG + Intronic
1070663577 10:78327991-78328013 GAGGCACACATGGGTGCTGGTGG + Intergenic
1070742636 10:78912911-78912933 GAAGCAAGCAGAGGGGTAGGGGG + Intergenic
1071267412 10:83976413-83976435 GAAGCAAACAGGGGTGTTTGGGG + Intergenic
1071378071 10:85030998-85031020 AAAGCAAACAGGGGTGTTGGGGG - Intergenic
1071943100 10:90610195-90610217 GGAGCAAACAGGGGTGTTGAGGG + Intergenic
1071986769 10:91059532-91059554 GAAGAAAATAAGGGTGGTGGGGG - Intergenic
1072019850 10:91387554-91387576 GAAGCGAACATGGGTTCTGGAGG - Intergenic
1072165645 10:92810234-92810256 GAGGCAATCAAAGGTGTTGGGGG + Intergenic
1072209585 10:93234110-93234132 GAAGCAAACAGAGGTGTTGAGGG + Intergenic
1072305895 10:94106959-94106981 GAAGGAGAAAAGGGTGTTGGGGG - Intronic
1072360158 10:94651728-94651750 GAAGCAAACAGGAGTGTTGGGGG - Intergenic
1073557008 10:104463483-104463505 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1073656983 10:105426729-105426751 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1074244626 10:111676444-111676466 GAAGCAAACAGGGATGTTGGGGG - Intergenic
1075606551 10:123815696-123815718 GAAGGAAACAGGGGTGTTGGGGG - Intronic
1076122832 10:127950027-127950049 GAAGGAAAGAGGGTTGGTGGGGG - Intronic
1076324910 10:129613691-129613713 GATGCACACAGGAGTCTTGGCGG + Intronic
1076662080 10:132062394-132062416 GATGCAGACAGGGGTGCTCGTGG + Intergenic
1076927737 10:133501651-133501673 GAAGCAAACAGAGGTGTTGGAGG + Intergenic
1077380571 11:2235127-2235149 GAAGCAAAGGGAGGTGGTGGGGG - Intergenic
1077801743 11:5545973-5545995 GAAGCAAACAGTTGTCTTGGGGG - Intronic
1079166322 11:18046606-18046628 GAAGCACAGAGAGGTGTGGGAGG - Intergenic
1080020414 11:27554036-27554058 GAAGAAAAGAGGAGTGTTGGAGG + Intergenic
1080182430 11:29441527-29441549 GAAGCAAACAGGAGAGTGGGTGG + Intergenic
1080606733 11:33870047-33870069 GAAGAAAAAAGGGGAGGTGGGGG - Intronic
1080750449 11:35145717-35145739 GAAGCAGACATGGGGGTTGGAGG - Intronic
1080976524 11:37349417-37349439 GAAACAAACAGGGGTGTTGGGGG - Intergenic
1081072473 11:38628673-38628695 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
1081110142 11:39125956-39125978 GAAGCAAACAGGGGTGTTGGAGG - Intergenic
1081590060 11:44416372-44416394 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
1081608712 11:44545417-44545439 GAAGCAAACAGAGGTGTTGGAGG - Intergenic
1082666159 11:55978751-55978773 GAACAAAACAGTGGTGTTGGAGG + Intergenic
1082671377 11:56040615-56040637 GAAGTAAACAGGAGTGTCTGGGG - Intergenic
1082999304 11:59277113-59277135 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
1083700244 11:64472520-64472542 TGAGCCAACAGTGGTGTTGGGGG + Intergenic
1083804478 11:65065958-65065980 GAAGGATACTGGGGTGTAGGCGG - Intergenic
1083900405 11:65640741-65640763 GAAGCCAACACGGGTGGTGGAGG + Intronic
1084212862 11:67631848-67631870 GAGCCAAGCAGGGGTCTTGGAGG + Exonic
1084599680 11:70137427-70137449 GCAGCAGACAGCGGTGATGGCGG - Intronic
1085002637 11:73054630-73054652 GAAACAAACAGAGGGGGTGGAGG + Intronic
1085527134 11:77170743-77170765 GAAGCAAAGAGACGAGTTGGGGG + Intronic
1085747254 11:79125809-79125831 GAAGCAAACAGGGGTGTTGGGGG - Intronic
1086141672 11:83506510-83506532 GACGCAAATAGGGGTGTTGGAGG + Intronic
1086278310 11:85158032-85158054 GAAGCAAACAGGGCTGTTGGGGG - Intronic
1086753858 11:90533488-90533510 GAAGGACACTGGGGTGATGGTGG - Intergenic
1086769120 11:90738846-90738868 GAAGCAAAAAAGGGAGTTAGTGG - Intergenic
1086833808 11:91597959-91597981 GAAGCAAACAGCATTGTTGGGGG - Intergenic
1086961876 11:92986272-92986294 GAAGCAAACAGAGGTGCTGGGGG + Intergenic
1087361500 11:97166157-97166179 GAAGCAATAATGGGAGTTGGGGG + Intergenic
1087673064 11:101128778-101128800 GAAGCTACAAGGGGTGCTGGAGG - Exonic
1088192008 11:107236936-107236958 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1088264823 11:107979112-107979134 GAAACAAGCAGGGGTGTTGGGGG - Intergenic
1088449028 11:109962911-109962933 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1088568307 11:111196491-111196513 GCAGGAGACAGGGTTGTTGGAGG + Intergenic
1089001957 11:115059631-115059653 GAAGCAAACCTGGGTGTCCGAGG - Intergenic
1089399038 11:118153728-118153750 GAAGAAAACAGGAGAGTTGGAGG - Intergenic
1090083336 11:123629110-123629132 GAAGCAGGCTGGGGTGCTGGGGG + Intergenic
1091104054 11:132901971-132901993 GACGCAAACACCGGTGGTGGGGG - Intronic
1091131438 11:133150305-133150327 GAAGCCCTCAGGGCTGTTGGAGG - Intronic
1091384559 12:84717-84739 GAAGCAAACAGCTGTTTTTGTGG + Intronic
1091807829 12:3368185-3368207 GGAGCAAGAAGGGGTGATGGTGG + Intergenic
1092092946 12:5819195-5819217 GAAGCAAACAGGGGTGTTGGGGG - Intronic
1092656454 12:10689951-10689973 GAAGAAAATAAGGGTGTTGAGGG + Intergenic
1093035932 12:14332603-14332625 GAAGCAAACAGACGTGTTCGGGG - Intergenic
1093964230 12:25308509-25308531 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1093970475 12:25371097-25371119 GAATCAGCCAGGGGTGGTGGAGG + Intergenic
1094482660 12:30897055-30897077 GAAGCACACAGTGGTACTGGAGG - Intergenic
1094561515 12:31558268-31558290 AAAGAAAACAAGGGGGTTGGGGG - Intronic
1095603758 12:44043662-44043684 GAAGCAAATAGGGGTGTTGGGGG - Intronic
1095844794 12:46732924-46732946 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1095856548 12:46866104-46866126 GAGGCAAACAGGGGTGTTGGGGG + Intergenic
1096457854 12:51802165-51802187 GAAACAAACAGGGGTGTTGGGGG + Intronic
1097431825 12:59518654-59518676 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1097821756 12:64134945-64134967 GAAGCAAACAGAAGTGTTGGAGG + Intronic
1098730751 12:74034931-74034953 GAAGCAAACAGGGGTATTGAGGG - Intergenic
1098805136 12:75013640-75013662 GAAGAAAACAGGGGTGTTGGGGG - Intergenic
1099184108 12:79499106-79499128 AAAGCAAACAGGGGTGCTGTGGG + Intergenic
1099350702 12:81565273-81565295 GAAGCAAACAGGAGTGTTGGGGG - Intronic
1099375329 12:81891536-81891558 AAAGCAAACAGGGATGTTGGGGG - Intergenic
1099379981 12:81941176-81941198 GAAGCAAACAGGTGTGTTGGGGG + Intergenic
1099813980 12:87621653-87621675 GAAGCCCAAAGAGGTGTTGGAGG + Intergenic
1100083001 12:90875800-90875822 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1100241497 12:92714128-92714150 GAGGCAAACAAGGTTGTTGGGGG + Intergenic
1100270062 12:93016157-93016179 GAAGCTCACAGGGGTTTGGGTGG - Intergenic
1101535007 12:105608545-105608567 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1103035236 12:117651294-117651316 GAAGCAAACAGGGGTATTGGGGG - Intronic
1103389111 12:120557609-120557631 GAGGGAGAAAGGGGTGTTGGTGG + Exonic
1103396186 12:120609012-120609034 GAAGCAAACAGGGGTGTTGGTGG - Intergenic
1103745861 12:123123084-123123106 GAAGCAAACAGTGCTGTAGCAGG - Intronic
1103968741 12:124656223-124656245 GAAGGGAACAGGGGAGTAGGAGG + Intergenic
1104053226 12:125210318-125210340 GAAGCCATCAGGTGTGTTAGAGG + Intronic
1104708640 12:130968802-130968824 AAAGTAAACAAGGGTGGTGGAGG + Intronic
1104729854 12:131098702-131098724 GAAACACACAGGGGCGGTGGCGG - Intronic
1105896760 13:24723235-24723257 GAAGCAAAGAGGGGCCATGGAGG - Intergenic
1107424730 13:40281633-40281655 GAAGCAAGCAGGGGTGTTGGGGG + Intergenic
1108642486 13:52395677-52395699 GAAGCAAGCAGGGAGGTGGGAGG + Intronic
1108888928 13:55228636-55228658 GAAGTAAAGAGGGGTTGTGGAGG - Intergenic
1108903931 13:55447250-55447272 GAAGCAAACAGGGGTTTTGCAGG - Intergenic
1108914608 13:55591332-55591354 GAAGCAAACAGGGGTTTTGGGGG + Intergenic
1109392065 13:61706453-61706475 GAAGCAAAGAGGGATGGTGAAGG - Intergenic
1109582737 13:64363705-64363727 GAAGCAGACAGGGACGTTGGGGG - Intergenic
1109704835 13:66076834-66076856 GAAGCAAAGAGTGGTGGTAGGGG - Intergenic
1109712992 13:66183417-66183439 AAAGCAAATAGCCGTGTTGGGGG + Intergenic
1109951332 13:69504598-69504620 AAAGCAAACAGAGGTGTTGGGGG + Intergenic
1110995164 13:82098074-82098096 GGAGAAAACAGGACTGTTGGTGG + Intergenic
1111016499 13:82388260-82388282 GAAGCAAACAGAGGTGTTGGGGG + Intergenic
1111440773 13:88280734-88280756 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1111576070 13:90155199-90155221 GGAGCCAACAGGGGTTTGGGGGG + Intergenic
1112231459 13:97592591-97592613 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1112455310 13:99556318-99556340 GAACTAAACAGAGGTGGTGGTGG - Intronic
1112606394 13:100910718-100910740 GAAGCAAAGAGTGGAATTGGAGG + Intergenic
1112659752 13:101494145-101494167 AAAGCAAACAGGGGATTTAGAGG + Intronic
1113111866 13:106831918-106831940 GAAGAAAAGAGGGGTGATGAGGG + Intergenic
1113722468 13:112570031-112570053 GAAGCAAGCAGGGCTGAAGGGGG + Intronic
1113975674 13:114225646-114225668 GAGGCAAAAAGGGGAGTGGGAGG + Intergenic
1114205588 14:20568666-20568688 GAAGCAGATAGGAGTGTTAGGGG - Intergenic
1114553989 14:23551119-23551141 ATAGCAGACAGGGGTGTGGGAGG - Intronic
1114758573 14:25286162-25286184 AAAGCAAACAGAGGTGTTGGGGG + Intergenic
1116058596 14:39894505-39894527 GAAGCAAACAGGAGTGTTGCAGG - Intergenic
1116158707 14:41239107-41239129 GAAGCAAACAGGAGAATTGGGGG + Intergenic
1116414759 14:44666877-44666899 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1116531770 14:45980635-45980657 GAAGAAAACAGGGGTGTTAGGGG + Intergenic
1117001254 14:51373852-51373874 GAAGCAAACAGGGGTGTTAGGGG - Intergenic
1117216501 14:53557668-53557690 GAAGCAAACAGAGGTGTTGAGGG - Intergenic
1117596599 14:57332329-57332351 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1117633801 14:57721954-57721976 GAAGAAAACAGGAGTGTTGGGGG - Intronic
1117690004 14:58297387-58297409 AAAGCAAACAGTGGTTTTGCAGG - Intronic
1117999529 14:61510248-61510270 GAAGCCAACAGAGGTTTTTGAGG + Intronic
1118881091 14:69826455-69826477 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1119060078 14:71464907-71464929 GAAGCAAACAGGGGTGTTGAGGG + Intronic
1119386569 14:74261045-74261067 GCAGCCACCAGGGGTGATGGAGG - Exonic
1120082347 14:80229977-80229999 GAAGCAAACAGGGGTGTTGGGGG + Intronic
1120250795 14:82060175-82060197 GAAGCAAAGAGGAGGGGTGGTGG + Intergenic
1120556315 14:85932864-85932886 GAAGGAAACAGGGGTGTTGGAGG + Intergenic
1120973332 14:90228019-90228041 GAAGCAGACAGGGGTGTTGAGGG - Intergenic
1121371046 14:93358854-93358876 GAAGTAGACAAGGGTGTTGGGGG - Intronic
1121831381 14:97055259-97055281 GAAGAAAGAAGGGGTGTTGAGGG - Intergenic
1123213943 14:106788727-106788749 GAAGCGGACCGGGGTGTGGGGGG - Intergenic
1124466086 15:29941238-29941260 GAAGCGAACAGGGGAGTTTCTGG - Intronic
1125368297 15:38942728-38942750 GAGATAAACAGGGTTGTTGGTGG + Intergenic
1125709525 15:41773792-41773814 GAAGCACAATGGGATGTTGGAGG + Intergenic
1126009597 15:44289482-44289504 GACAGAAACAGGGTTGTTGGGGG - Intronic
1129653609 15:77508327-77508349 GAAGCAACGAAGGGAGTTGGCGG - Intergenic
1129961715 15:79692496-79692518 GAAGCAAACAGAGGTGTTGGGGG + Intergenic
1129962223 15:79697649-79697671 GAAGTAAACAGAGTGGTTGGAGG - Intergenic
1130065093 15:80596389-80596411 TAAGAAAATAGGGGTGATGGAGG + Exonic
1130124470 15:81081468-81081490 GAAGTGAACAGAGGGGTTGGGGG + Intronic
1131937329 15:97521373-97521395 GAAGCAAAGCGGGGAGTGGGTGG - Intergenic
1134196321 16:12162000-12162022 GAAACCAACAGGGGTGGTGAGGG - Intronic
1134693085 16:16203780-16203802 GAGGCAATCATGGGAGTTGGGGG + Intronic
1135263357 16:21000224-21000246 GAAGAAAGCAGTGGTGTTTGTGG - Exonic
1135554198 16:23422608-23422630 GAAGCAAATAATGTTGTTGGTGG + Intronic
1135925462 16:26689870-26689892 GAAGAGCACAGGGGTGTTTGTGG - Intergenic
1138007678 16:53353513-53353535 CAAACAAACAAGGGTGCTGGAGG - Intergenic
1138134984 16:54513676-54513698 GAAGCAATGAGAGATGTTGGTGG - Intergenic
1138620935 16:58210813-58210835 GAAGCATGCTGGTGTGTTGGAGG + Intergenic
1138819320 16:60239968-60239990 GAAGTAGACAGAGGTGGTGGTGG - Intergenic
1139107359 16:63842922-63842944 GAAGAAAACAGGAGTTATGGTGG + Intergenic
1139157025 16:64455885-64455907 TAAGCAAACAGGAGTCTTGCAGG + Intergenic
1139364698 16:66426519-66426541 GAAGGAAACAGGCCTGCTGGTGG + Intergenic
1139945101 16:70635411-70635433 GAAGCACAAAGGCCTGTTGGAGG + Intronic
1140318299 16:73921361-73921383 CAAGCAAACATGGGGGTTGCAGG + Intergenic
1141398738 16:83727837-83727859 GGAGTGAACAGGGGCGTTGGCGG + Intronic
1142945930 17:3427063-3427085 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1143189890 17:5033502-5033524 GAAGCAGGCAAGGGGGTTGGCGG + Exonic
1143336332 17:6174312-6174334 GAAGCAAAGAGGAGTGGTCGGGG + Intergenic
1143645517 17:8227613-8227635 GAAGTAAATTGGGGAGTTGGCGG - Intronic
1144954264 17:19011285-19011307 GAGGTAAACAAGGGTGTGGGTGG + Intronic
1146237876 17:31185186-31185208 GAAGCAAACAGGGGTGTTGGGGG - Intronic
1147913448 17:43871983-43872005 TAAGCATACAAGTGTGTTGGAGG + Intergenic
1148459637 17:47831738-47831760 GCAGCAAGCTGGGGTGTTGTGGG - Exonic
1148506516 17:48131646-48131668 GGGGCAAACAGGGATGTTAGTGG - Intergenic
1149236332 17:54594681-54594703 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1149337071 17:55646279-55646301 GAAGCAAACAGATATTTTGGAGG - Intergenic
1149618974 17:58027451-58027473 GAAGCAATCAGGGTTTTTTGGGG + Intergenic
1151029554 17:70720845-70720867 GAAGCATAGTGTGGTGTTGGGGG - Intergenic
1151037938 17:70822652-70822674 GAAGCAAACAGGAGTGTTGCGGG + Intergenic
1151429265 17:74051543-74051565 GGAGCAGCCAGGGGGGTTGGTGG + Intergenic
1151500231 17:74483677-74483699 GAAGCACAGAGGTGTCTTGGGGG + Intronic
1151534845 17:74733003-74733025 GAGGCAATAAGAGGTGTTGGGGG + Intronic
1152162653 17:78678607-78678629 GAAGAAAACAGCAGTGTTGTGGG - Intronic
1152317279 17:79588570-79588592 GAAGCAAACAGCAGTGAAGGGGG - Intergenic
1152541408 17:80978573-80978595 GGTGCCAACAGGGGTTTTGGAGG - Intergenic
1153131592 18:1860128-1860150 GAAGCAAACAGGGGTGTTGGAGG + Intergenic
1153461324 18:5336699-5336721 GAAGCCAAGAGGGGTGATGCGGG + Intergenic
1153554462 18:6296630-6296652 AAAGCAGACAGGGGTCCTGGTGG + Intronic
1153642029 18:7165621-7165643 GAAGCACACTGTGGTCTTGGTGG - Intergenic
1154068149 18:11128697-11128719 GAAGCAAACAGAGGTGTTGGGGG - Intronic
1154077292 18:11215912-11215934 GAAGAAAACAGGGCTTTTTGGGG + Intergenic
1154415791 18:14174580-14174602 GAAGCAAGCTGTGGTGTTGCAGG + Intergenic
1154505875 18:15040429-15040451 GAAGCAAACAGGAGTGTTGGGGG - Intergenic
1155070460 18:22310774-22310796 GAAGTAAACAGGGGCTTTTGGGG - Intergenic
1155294642 18:24373998-24374020 GAGGCAAACATGGGTGGAGGTGG + Intronic
1155573524 18:27220769-27220791 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1156064830 18:33127822-33127844 GAAGCAGATAGGGTTGTTTGAGG - Intronic
1156192364 18:34734150-34734172 GAAGCAAACAGAGGTATTGAGGG + Intronic
1156303549 18:35856326-35856348 GAAGCAAACAAGAGTGTTGGGGG - Intergenic
1156537462 18:37878089-37878111 GAAGCAAACAGGGGTCTTGGGGG - Intergenic
1156998282 18:43495277-43495299 GAAGCAAACATGGCTATTGGCGG - Intergenic
1158524142 18:58197418-58197440 GAAGCAAACGGGGGTGTCTCAGG - Intronic
1158909354 18:62044408-62044430 GTAGCAAACAGTGATGTTGATGG - Exonic
1159287475 18:66373027-66373049 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
1159339966 18:67121988-67122010 GAAGAGAAAAGGGTTGTTGGTGG + Intergenic
1159559407 18:69977601-69977623 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1160494901 18:79367607-79367629 GAAGGAACCAGGGCAGTTGGAGG + Intronic
1160980280 19:1813418-1813440 GAGGCAAACATGGGTGGAGGGGG + Intergenic
1161735668 19:5990801-5990823 GAGGAAAACAGGGGTGGCGGCGG + Intergenic
1161901521 19:7122998-7123020 CAAGCAACCAGGGTTCTTGGAGG + Intronic
1162854142 19:13455243-13455265 AAAGAAAAGAAGGGTGTTGGAGG + Intronic
1163246093 19:16095388-16095410 GAAGCCCACAGGGGCGTAGGAGG - Intronic
1164097445 19:22024104-22024126 GAAGCAAACAGGGGTGTTGAGGG + Intergenic
1164117630 19:22237553-22237575 GAAGCAAACAGGGGTGTTGAGGG + Intergenic
1164824471 19:31274385-31274407 TAAGCAGGCAGGGGTGTTGTGGG - Intergenic
1166052711 19:40269959-40269981 GAAGCAAAGGGGGATGTTGCAGG - Intronic
1166626275 19:44358907-44358929 GAAGCGTATAGGGGTGGTGGGGG + Intronic
1166674645 19:44732554-44732576 GAGGCAGAAAGGGGTGTGGGTGG + Intergenic
1167642758 19:50690867-50690889 GGAGCATACAGGGGTGCTTGTGG - Intronic
1167882306 19:52470256-52470278 GAGGCAAAGAAGGGTGGTGGGGG - Intronic
1168075191 19:53977501-53977523 GAAGCAAGCAGAGGTGTGTGAGG - Intronic
1168183991 19:54685438-54685460 GAAGCAAAGATGGGTAGTGGGGG + Intronic
1168539686 19:57199781-57199803 GAAGCAAACAAAGGTGTTGAGGG + Intronic
925023808 2:592584-592606 GCAGCAAACAGCAGTGGTGGAGG - Intergenic
925499714 2:4489352-4489374 GGAGCAAACAGGGGTGTTGGGGG + Intergenic
926403862 2:12527977-12527999 GGGGCCTACAGGGGTGTTGGGGG + Intergenic
926810713 2:16753124-16753146 GAAGCAAACAGGGGTGGTGGGGG + Intergenic
926872619 2:17439980-17440002 TAAGCATCCAGGGGTGATGGGGG + Intergenic
927008583 2:18878669-18878691 GAAGCAAACGGGGATGTTGGGGG - Intergenic
927080621 2:19626184-19626206 GCAGCATGCATGGGTGTTGGTGG - Intergenic
927476350 2:23417147-23417169 GAACCAAGCAGGGGTCTTGGTGG - Intronic
928028913 2:27762286-27762308 GAAGCCAACAGAGGTGCTAGAGG + Intergenic
928233229 2:29518035-29518057 GAATAAAACAGGGTTGGTGGTGG + Intronic
928265379 2:29806873-29806895 GGAACAAACAGGGTTCTTGGAGG + Intronic
928501715 2:31903409-31903431 GAAAAAAACAGGGGGGTGGGGGG + Intronic
928535452 2:32235618-32235640 GAAGAACAAAGGGGTGTTAGGGG + Intronic
930221554 2:48751415-48751437 GAAGGAAAGAGGGGTCCTGGTGG - Intronic
930295467 2:49547989-49548011 GAAGCAAACAGGGATATTAGGGG + Intergenic
930456584 2:51614202-51614224 GAAGCAAAAAGGGGTGTTGGGGG + Intergenic
930872728 2:56184523-56184545 GGAGCGCACAGGGGTGTGGGCGG + Exonic
931519037 2:63074844-63074866 GAAACAGACAGGGGTGATGGTGG - Intergenic
934858240 2:97742075-97742097 GAAACAAAGAGAGGTTTTGGCGG + Intergenic
935425421 2:102913765-102913787 GAAGCAAACAGAGGTGTCGGGGG + Intergenic
935544268 2:104384235-104384257 GCAGCAAACAGAGCTTTTGGTGG - Intergenic
935564634 2:104592673-104592695 GAAGCAAACACGGGTGTTGTGGG + Intergenic
936018777 2:108979324-108979346 CCAGCAAACAAGAGTGTTGGAGG - Intronic
936640968 2:114312589-114312611 GAAGCAAACAGGGGTATTGCGGG - Intergenic
937644457 2:124250636-124250658 GCAGCATACAGGGGAGCTGGAGG + Intronic
937800014 2:126072308-126072330 GAAGCAAACAGGGGTTTTGGGGG - Intergenic
937852881 2:126651157-126651179 GAAGCAAACAGAGGTGTTGGGGG + Intergenic
939068768 2:137515418-137515440 GAAGCAAACAGGGGTGTTAGGGG - Intronic
939086196 2:137721264-137721286 GAAGAAAACAGGGGTGTTGGGGG - Intergenic
939213501 2:139209479-139209501 GAAGAAAACAGGGGTGTTGGGGG - Intergenic
939788998 2:146548518-146548540 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
940171646 2:150835159-150835181 GAAGCAAACAGGAGTGTTGGGGG + Intergenic
940606235 2:155926797-155926819 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
940908165 2:159187083-159187105 GAGGGAAACAGGGCTGTTGGAGG - Intronic
942686654 2:178539753-178539775 GAAGCAGACAGGGGTGATTCTGG - Exonic
942987604 2:182161612-182161634 GAAGCAAAGAGGGGTGGTAGGGG - Intronic
943239523 2:185365035-185365057 GAAGCAAACATGGGTGTTAGGGG + Intergenic
943318158 2:186414090-186414112 GAAGCAAACAGGGGTACTGGTGG + Intergenic
943384336 2:187183296-187183318 GGAGCAAACGGGGATGTTGGGGG + Intergenic
943509160 2:188802851-188802873 GAAGCAAACAGAAGTGTTGGGGG - Intergenic
943517912 2:188909682-188909704 GAAGCAAACAGGGATGTTGGGGG + Intergenic
944011902 2:194983490-194983512 GAAGGAAACAGTGGTAGTGGTGG - Intergenic
944900270 2:204206814-204206836 GAAGGAAAGAGGGGTGAGGGAGG - Intergenic
944987036 2:205188818-205188840 AAAGGAAAAAAGGGTGTTGGAGG + Intronic
945146365 2:206742582-206742604 GAAGCAAACAAGGGTGTTAGGGG - Intronic
945544569 2:211135731-211135753 GAAGCAAATAGGGGTGTTGTGGG - Intergenic
945641856 2:212441412-212441434 GAAGCAAACAGAGGTGATGGGGG - Intronic
946321145 2:218955231-218955253 GAGGCAAAAAGGGGGCTTGGTGG + Intergenic
946528180 2:220542403-220542425 GAAGCAAACAGGAATGTTGAGGG + Intergenic
946727248 2:222672598-222672620 GAAGTAAATAGGGGTGATGTGGG + Intronic
946790610 2:223297311-223297333 GAAGCAAATGGGGGTGTTGGGGG - Intergenic
947136955 2:226984952-226984974 GAAGCAAAGAGGAGGATTGGGGG + Intronic
948340696 2:237248953-237248975 GGAGCAAAGAGGGGTGGTGGGGG + Intergenic
948676832 2:239601751-239601773 GGAGCAGACAGGGGTGCTGCCGG + Intergenic
1169894782 20:10491317-10491339 GAAAAAAACAGGGGAGTTGAGGG - Intronic
1170990662 20:21299111-21299133 GAAGCCAAGAGGGGTAATGGGGG + Intergenic
1171238424 20:23546410-23546432 GGAGCAGACAGGGGAGGTGGTGG + Intergenic
1171243242 20:23588017-23588039 GGAGCAGACAGGGGAGGTGGTGG - Intergenic
1171296377 20:24020656-24020678 GAAGAAAACAGGGGTGTTGGGGG - Intergenic
1172484241 20:35288751-35288773 GCAGTAACCAGGGGTGTGGGCGG - Intronic
1172670350 20:36630720-36630742 GAGGCAAAGAGGGATGTTGAAGG - Intronic
1172930657 20:38584087-38584109 GGAGCCAGCAGGAGTGTTGGGGG - Intronic
1173375648 20:42480356-42480378 GAGACAAACAGGGGTTGTGGAGG + Intronic
1173709461 20:45141685-45141707 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1173968611 20:47132974-47132996 CAAGCAAAAACGGGTGTTTGCGG - Intronic
1174540924 20:51288625-51288647 GAGGCAGACAGGGTTGATGGGGG + Intergenic
1174910907 20:54606510-54606532 GAAGCAGACATGGCTGTAGGAGG + Intronic
1175665472 20:60854892-60854914 GAAGGAGCCAGGTGTGTTGGGGG - Intergenic
1176212980 20:63934312-63934334 AAAGCAGGCAGGGGTGCTGGGGG - Exonic
1176791988 21:13328597-13328619 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1176997835 21:15577785-15577807 GAAGCAAACAGGGGTTTTGGGGG - Intergenic
1177002947 21:15635981-15636003 AAAGCAAACAGAGGTGTTGAGGG + Intergenic
1177560769 21:22749220-22749242 TAAGCAAATATGAGTGTTGGAGG - Intergenic
1177912871 21:27053789-27053811 GAAGCAAACAAGGGTGTTGGGGG - Intergenic
1177991385 21:28039603-28039625 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1178012317 21:28302474-28302496 GAAGCAATCAGGGGTGTTGAGGG - Intergenic
1178061062 21:28853588-28853610 GAAGCAAACAGGAGTGTTGGGGG + Intergenic
1178350409 21:31869141-31869163 GAAGCACAGAGGGGTGTGTGTGG + Intergenic
1178764147 21:35433373-35433395 GAAGCAAACAGGGGTGTTAGGGG + Intronic
1179043798 21:37828235-37828257 AAAGCACACCGGGGTGTAGGTGG + Intronic
1179647907 21:42786370-42786392 GAGGTTAGCAGGGGTGTTGGAGG - Intergenic
1181624685 22:24115240-24115262 GAAGGGGACATGGGTGTTGGGGG + Intronic
1181626925 22:24128664-24128686 GGAGGAAACAGGAGTGGTGGAGG - Intronic
1182965695 22:34519242-34519264 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1183629525 22:39024926-39024948 AAACCAAACAGGGGGGATGGAGG + Intronic
1183648925 22:39142609-39142631 GAAGTAAACAGGAGTGCTAGTGG - Intronic
1184603890 22:45560834-45560856 GAGGCAAACAGGGGTGTTAGGGG + Intronic
1184786700 22:46675573-46675595 GAAGAAAACACGGGGGTTAGTGG - Intronic
949125981 3:445593-445615 GAAGTAAACAGGGGTGTTGGGGG + Intergenic
949245548 3:1922475-1922497 GAGGCAAACAGAGGTGTTGGGGG - Intergenic
949417978 3:3833624-3833646 GAAGCAAACAGGGGTATTAGGGG + Intronic
949638465 3:6010084-6010106 GAAGCAAATAGAGGTGTTGGGGG - Intergenic
949751043 3:7353140-7353162 GAAGCAAAAAAGGCTGGTGGAGG - Intronic
950577591 3:13842068-13842090 GAAGGAGACAGGGGTGAGGGAGG + Intronic
951003259 3:17590062-17590084 GAAACAAACAGGAATGTTGTAGG - Intronic
951384221 3:22025321-22025343 CAAGCAAACAGAGGTTTTGGGGG - Intronic
951978406 3:28540113-28540135 GAAGCAAAGAGGGGTTCTGGGGG - Intergenic
952688876 3:36180275-36180297 GTAGGACACAGGGGTGTTTGGGG + Intergenic
953521121 3:43644377-43644399 GAAGCAAACATGGGGGTGGGAGG + Intronic
953590428 3:44247084-44247106 AAAGTAAAAAGCGGTGTTGGGGG + Intronic
953897717 3:46814942-46814964 GAAGCAAATGGGGGTGTTGGGGG + Intergenic
953992903 3:47497685-47497707 GAAGCAAAGGGGGGTGGGGGTGG + Intronic
954413527 3:50381634-50381656 GAAGCAAGCAGGGGTGGGGGCGG + Intronic
954511948 3:51133041-51133063 TAAGTAAACAAGGGTGTTGGGGG - Intronic
954644872 3:52125030-52125052 GAACCAAACAGGGTGTTTGGGGG - Intronic
954934402 3:54313456-54313478 GGAGCCACCAGGGGTGTTGAGGG - Intronic
956509322 3:69977920-69977942 AAAGCAAACAGGGGTGTTGGGGG - Intergenic
957247854 3:77735773-77735795 CAAGCAAACAGAGGTGTTGGGGG + Intergenic
957634133 3:82759692-82759714 GAAGAAAACAGGCGTGTAGAGGG - Intergenic
957897804 3:86446309-86446331 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
958789163 3:98631020-98631042 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
958890750 3:99780075-99780097 AAAGAAAACAGGGGTGGTGGTGG - Intronic
959204103 3:103283224-103283246 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
959377709 3:105605607-105605629 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
959981588 3:112523829-112523851 GAACAAAACAATGGTGTTGGAGG + Intergenic
960349240 3:116573548-116573570 GAAGCAAACAGGGGTCTTGGGGG - Intronic
960729581 3:120711480-120711502 AAAACAAACAGGGAGGTTGGGGG - Intronic
963566546 3:146938247-146938269 GAAGCAAACAAGGGTGTTGGCGG - Intergenic
963629987 3:147720782-147720804 GAAGCAAACAGAGGTGTTTGGGG - Intergenic
964404202 3:156331324-156331346 GAAAAAATCAGGGGTGGTGGGGG + Intronic
964660796 3:159118211-159118233 GAAGCGATCAGGCTTGTTGGAGG + Intronic
964977515 3:162638231-162638253 GAAGCAAACAGGGGTATTCGGGG + Intergenic
965191141 3:165530987-165531009 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
965207579 3:165742028-165742050 GAAGCAAACAGGGATGTGAGTGG - Intergenic
965251795 3:166352082-166352104 GAAGCCAACAGGGGTGTTGGGGG + Intergenic
965299240 3:166989251-166989273 GAGGCAAACAGGGGTGTTGGGGG + Intergenic
965391583 3:168110858-168110880 GAAGCAAAGTGGGGTGTTGGTGG + Intergenic
965837776 3:172870107-172870129 GAAACATACAAGGGTCTTGGAGG + Intergenic
965996112 3:174884877-174884899 GAGGTAAACAGGAGTGTTGGGGG + Intronic
966044642 3:175533361-175533383 GAAGCAAACAGGGGTGTTGGGGG + Intronic
966445353 3:179996133-179996155 GAAGCTAACAGGGGTGTTGGGGG - Intronic
966896952 3:184452333-184452355 GAAGCAAAAAGGGGTGGTGGGGG + Intronic
967831444 3:193923534-193923556 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
968291997 3:197546337-197546359 TAAGCAACCAGAGGTGGTGGTGG - Intronic
970089512 4:12388797-12388819 GAAACAAACAGGGGTGTTAGGGG + Intergenic
971002816 4:22341408-22341430 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
971101328 4:23468862-23468884 GAAGCAAACAGGGGTGTTAGGGG + Intergenic
971816919 4:31502620-31502642 GAAGCAAACAAGAGTGTTGGGGG - Intergenic
971897467 4:32616237-32616259 GAAGAAAAGAGGGGTGGTGATGG - Intergenic
972192590 4:36612835-36612857 GTAGCAAACAGGGGTGTTGGGGG - Intergenic
972805650 4:42527594-42527616 GAAGCAAACAGGGGTGTTGGGGG - Intronic
973036457 4:45413339-45413361 GAAGCAAAGAGGGATAGTGGAGG - Intergenic
973118125 4:46486606-46486628 GAAGCAAACAGGGATGTTGGGGG - Intergenic
973121328 4:46523682-46523704 GAAGCAGACAGAGGTGTTGGGGG + Intergenic
973599848 4:52531486-52531508 GAAACTAACAGAGGTGTTGCAGG - Intergenic
974458852 4:62162798-62162820 GAAGCAAGCAGGGGTGTTGGGGG - Intergenic
974644931 4:64677218-64677240 GAAGCAAACAGGGGTGTCAGGGG + Intergenic
974747215 4:66091367-66091389 GAAGCAAACACGGGTTTTGGAGG + Intergenic
975533685 4:75426672-75426694 GAAGCCAACAGGGAGGTTGTGGG + Intergenic
975734017 4:77364450-77364472 GAAGCAAACAGGGGTGTTGGGGG + Intronic
976034509 4:80798192-80798214 GAAGCAAACAGGGGTGTTGGGGG + Intronic
976302684 4:83530202-83530224 GAACCAGACAGGAGTGATGGAGG - Intergenic
976750727 4:88449285-88449307 GAATGAAACAGGGATCTTGGTGG + Intergenic
977465676 4:97380963-97380985 GAAGCAAACAGGGGTGTTGGAGG - Intronic
977626924 4:99197764-99197786 GAAGCAAACGGGGGTGTTGGGGG + Intergenic
977702056 4:100032325-100032347 GAGGCAAACAGGGGTATTGGGGG + Intergenic
977847375 4:101781614-101781636 GAAGCAAAGAAGGGTGGTGGGGG + Intronic
977930703 4:102745948-102745970 GAAGCAAACAGGGGTGTTGGGGG + Intronic
977962793 4:103104490-103104512 GGAGCATAGAGGGGTGGTGGGGG - Intergenic
978342154 4:107730040-107730062 GAGGCAAACAGAGGTGTTGGGGG + Intergenic
979084637 4:116391160-116391182 AAAGCAAAGAGAGGTGATGGAGG - Intergenic
979766711 4:124472357-124472379 GAAGCAAACAGGGATATTGGGGG - Intergenic
979885617 4:126024417-126024439 GATGCAAACACAAGTGTTGGTGG + Intergenic
980386558 4:132092923-132092945 GAAGCAAACAGTGGTGTTGGGGG + Intergenic
980406214 4:132356251-132356273 GAAGCAAACAGGGGCGTTGGGGG + Intergenic
980415408 4:132482596-132482618 GAAACAAACAAAGGTGTTGGTGG - Intergenic
980497844 4:133607819-133607841 GAAGCAAACAGGAGAGTTGGGGG + Intergenic
980588734 4:134855159-134855181 GAAGCAAACAGGAGATTTGAGGG + Intergenic
980601848 4:135037039-135037061 GAAGCAAACTAGGGTGTTGGGGG - Intergenic
980957448 4:139443930-139443952 GAAGCAAACAAGGGTATTGGGGG - Intergenic
981266154 4:142785909-142785931 GAAGAAGCCAGGGGGGTTGGAGG + Intronic
981462474 4:145029353-145029375 GAAGCAAACAAGGGTGTCGGGGG - Intronic
981834539 4:149040016-149040038 GAAGCAAACAGAGGTGTTGCGGG - Intergenic
982526884 4:156489972-156489994 GAAGCAAACAGGGTTGTTGTGGG - Intergenic
982835185 4:160114124-160114146 GAAACAAATAGGCGTGTTGGGGG - Intergenic
982847466 4:160271861-160271883 GAAGCAAACAGGAGTGTTGGTGG - Intergenic
982874704 4:160632031-160632053 GAAGCAAACATCACTGTTGGAGG - Intergenic
983184748 4:164689176-164689198 GAAACAAACAGGGGTGCTGGGGG - Intergenic
983581930 4:169317822-169317844 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
983842189 4:172470920-172470942 TACGCAAACCTGGGTGTTGGGGG - Intronic
984400821 4:179261722-179261744 GAAGCAAACCGGGGTGTTGGGGG - Intergenic
984485881 4:180368586-180368608 GAAGCAAACAAGAGTATTGCTGG + Intergenic
986037355 5:3952885-3952907 GAAGTAAACAGGGGTGTAGTGGG + Intergenic
986086798 5:4460274-4460296 GAAACAAACAGGGATTTTGGGGG - Intergenic
986938630 5:12921183-12921205 GAAGCAAACAAGGGTGTTGAGGG + Intergenic
986955855 5:13148580-13148602 GAAGCCAACAGGGGTGTTGGGGG + Intergenic
987657433 5:20824077-20824099 AAAGCAAACAGAGGTGTTGTGGG + Intergenic
987885312 5:23805471-23805493 GAAGCAAACAGGGGTTTTGGGGG - Intergenic
988005381 5:25403539-25403561 GAAGCAAAGAAGGGTGATGGGGG - Intergenic
988161124 5:27519316-27519338 GAAGCAAATAGGGTTGTTTGGGG + Intergenic
988169492 5:27635262-27635284 GAAGCAAACATGGGTGTTGGAGG + Intergenic
988188470 5:27898802-27898824 GAAGCAAACAGGGGTATTGCTGG - Intergenic
988233588 5:28509524-28509546 GAAGTAAACAGCAGTGTTGGGGG + Intergenic
988561805 5:32288438-32288460 GAAGCAAACAGGGGTGTTGGGGG - Intronic
988766113 5:34379869-34379891 AAAGCAAACAGAGGTGTTGTGGG - Intergenic
988974997 5:36506571-36506593 GAAGCTAAGAAGGGTATTGGGGG + Intergenic
989045631 5:37270678-37270700 GAAGCAAACAGAGGTGTTGGGGG + Intergenic
989097454 5:37794557-37794579 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
989213486 5:38880375-38880397 GCAGGAAACAGGAGCGTTGGAGG + Intronic
989219196 5:38936211-38936233 AAAGCGAACAGGGGTGTGGATGG - Intronic
989537018 5:42575498-42575520 GAATCCAACAGTGGTGTGGGTGG + Intronic
990145731 5:52758192-52758214 CAAGCAAACAGGAGAATTGGTGG - Intergenic
991033222 5:62103468-62103490 GAAGCAAATGGGGGTGTTGGTGG - Intergenic
991945816 5:71897699-71897721 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
992202613 5:74399230-74399252 GAAGAGGACATGGGTGTTGGTGG - Intergenic
993319527 5:86456164-86456186 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
993791470 5:92216475-92216497 GAAGCAAACTAGGGTGTTGGGGG - Intergenic
993901083 5:93584683-93584705 GAGGGGAGCAGGGGTGTTGGGGG + Exonic
993969286 5:94397259-94397281 GAAGCAAAGAGGAGAGATGGAGG - Intronic
994291702 5:98034422-98034444 GAAGCAAACAGGGGTGCTGGGGG + Intergenic
994572952 5:101537192-101537214 GAAGCCAACAGTGGTGTTCCTGG - Intergenic
994713567 5:103295731-103295753 GAAGAAGAGAGGGGTGTAGGTGG - Intergenic
994958147 5:106561893-106561915 GAAGTAAACAGGGGTGGTGGGGG - Intergenic
994984731 5:106918167-106918189 GAAGCAAACAGAGGTGTTGGGGG + Intergenic
995021987 5:107377425-107377447 TAGGCAAACGGGGGTGTTGGTGG + Exonic
995269870 5:110207910-110207932 GAAGCAAACAGGAATGTTGGGGG + Intergenic
995279387 5:110316342-110316364 GAAGTAAACAGGGGTGCTGGGGG + Intronic
995476814 5:112556246-112556268 GAAGGAAACGGGAGTGTGGGAGG - Intergenic
995831796 5:116362065-116362087 GAAGCAAAGAGGTGTTCTGGAGG + Intronic
996017626 5:118557990-118558012 GAAGGAAACAGGGGTGGAGGTGG + Intergenic
996165265 5:120214972-120214994 GAAGCAGACAGGGGTATTGGGGG + Intergenic
996266250 5:121544141-121544163 GAAGCAAACAGGGGTGTTGAGGG - Intergenic
996372510 5:122768275-122768297 AAATCAAACAGGTGTGGTGGCGG + Intergenic
996532191 5:124537959-124537981 GAAGAGAACAGGGGTGTGGAAGG - Intergenic
996825242 5:127675374-127675396 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
996909015 5:128634471-128634493 GAAGCAAAGAGGGGTGGTGGGGG + Intronic
997270735 5:132535610-132535632 GAGGCAATAAGGGGTGTTGAGGG - Intergenic
997602136 5:135147905-135147927 GAAGCAAACAGCAATGTGGGAGG + Intronic
998290661 5:140911033-140911055 GAAGCAAACAGGGGTGGTGGGGG + Intronic
998613737 5:143717341-143717363 GAAGAAAAATGGGGAGTTGGAGG + Intergenic
998807508 5:145933363-145933385 GATAGAAACAGGAGTGTTGGTGG + Intergenic
1000147526 5:158467934-158467956 TGAGGAAACAGTGGTGTTGGTGG + Intergenic
1000223608 5:159237041-159237063 GAAGCAAACAGGGGTGTTAGGGG + Intergenic
1000416651 5:160991503-160991525 GAAGCAAACAGGGGTGTTGGTGG - Intergenic
1000423172 5:161060589-161060611 GAAGCAAAAAGGGGTGGTGGGGG + Intergenic
1000730461 5:164828516-164828538 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1001680415 5:173552973-173552995 GAAGCACACAGGGTTGGAGGGGG + Intergenic
1003026300 6:2558532-2558554 GATGCTCACAGGGGTGTGGGGGG - Intergenic
1003233287 6:4273732-4273754 GAGGCAAACAGGCGTGTTACAGG + Intergenic
1003470225 6:6422517-6422539 GAAGCAAAGAAGGGTGGTGGAGG + Intergenic
1003696227 6:8408540-8408562 GAAGCAAACAGGGGTATTGGGGG + Intergenic
1003758280 6:9147602-9147624 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1004364377 6:14999531-14999553 CAACCACACAGGGATGTTGGGGG + Intergenic
1004824618 6:19405671-19405693 GAAGCAAACAGGAGTATTGGGGG + Intergenic
1005345302 6:24883479-24883501 GAAGCAGAGAGAGGTTTTGGGGG + Intronic
1005622787 6:27635437-27635459 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1006054814 6:31376388-31376410 GAATCACAGAGGGGTGTTGGGGG + Intergenic
1006062026 6:31430714-31430736 GAAGCAAACAGAGGTGTTAGGGG - Intergenic
1006581185 6:35078808-35078830 GAAGCAAACAGGGTTGTGTGCGG - Intronic
1008079680 6:47180800-47180822 GAAGCAAACAGGGTTGTTGGGGG + Intergenic
1008399965 6:51053039-51053061 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1009308327 6:62119859-62119881 GAAGCAAACAGGGGTGTTGGGGG - Intronic
1009390421 6:63137500-63137522 GAAGAAAACAGGAACGTTGGGGG + Intergenic
1009806162 6:68604371-68604393 GAAGCAAACAGGGCTGTTGGGGG - Intergenic
1010323257 6:74538027-74538049 GAAGCAGACAGGGATGTTGGGGG - Intergenic
1010325633 6:74559040-74559062 GAAGCAAATAGGGATGTTTGGGG + Intergenic
1010552116 6:77236278-77236300 GAAGCAGACAGGGGTGTTGAGGG - Intergenic
1010818274 6:80385664-80385686 GAAGCAAATAGAGGTGTAGAGGG - Intergenic
1010938471 6:81888148-81888170 GAAGCAAACAGGGGTATTGGGGG + Intergenic
1011039677 6:83015702-83015724 GAAGCAAACAGAGGTATTGGGGG + Intronic
1011068774 6:83359251-83359273 GAAGCAAACAGAGGTGTTGGGGG - Intronic
1012730150 6:102871893-102871915 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1012820488 6:104080488-104080510 GAAGCAAACAGAGGTATTGGGGG - Intergenic
1012976406 6:105785058-105785080 GAAGGAAACAGGAGAGTTGAAGG - Intergenic
1013226122 6:108120208-108120230 GAAGTAAATAGGGGTGGGGGGGG + Intronic
1013364304 6:109424202-109424224 GAAACAGACAGTGGGGTTGGGGG + Intronic
1014416687 6:121192942-121192964 GAAGTAAACAGGGGTGTTGGAGG - Intronic
1014456164 6:121637049-121637071 GAAGCAAACAGAGGTGTTGAGGG + Intergenic
1014534525 6:122599080-122599102 GAAGCAAACAGAGGTGTTGGGGG + Intronic
1014969934 6:127801767-127801789 GAAGCACACAGGGGTGTTGGGGG - Intronic
1015467247 6:133560668-133560690 GAAGGAAACAGGAGTGTTTGTGG + Intergenic
1015475415 6:133654878-133654900 GAAGCAAACCGGGGTGTTGCGGG - Intergenic
1016120219 6:140335085-140335107 GAAGCAAACAGGGGTGTTAGTGG + Intergenic
1016143971 6:140646961-140646983 GAAGCAAACAAGGATGTCAGGGG - Intergenic
1016147617 6:140695158-140695180 GGTGCAAACAGGGGTGTTGGGGG + Intergenic
1016219887 6:141655166-141655188 GAAACAAACATAGGTGTTGGGGG - Intergenic
1016420302 6:143875723-143875745 GAAGCAAACAGAGGTGTTGGAGG + Intronic
1016576568 6:145575039-145575061 GAAGCAGACAGAGCTGTTGGGGG + Intronic
1017044455 6:150334218-150334240 GAAGCAAACAGGGGTGAGGGGGG + Intergenic
1017228140 6:152043535-152043557 TAAGCAAACAGGGGTATTGAGGG + Intronic
1017942216 6:159062957-159062979 GAAGCAAATAGGGAGGTTGTGGG + Intergenic
1017977432 6:159370488-159370510 GAAGCAAACAGGGCCATTGTGGG + Intergenic
1018535311 6:164812916-164812938 TAAGCAAATAGGTGTGTTGAGGG + Intergenic
1018569646 6:165195628-165195650 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1020710003 7:11595172-11595194 GAAGCAAACAGGGGTGTTGGGGG - Intronic
1021922474 7:25499897-25499919 GCAGCATCCAGGGGTGTTGAAGG - Intergenic
1022044376 7:26611545-26611567 GAGGCCAACAGGGGTGATTGGGG - Intergenic
1022078571 7:26997897-26997919 GAAATAAACAGGGGTGTTGGGGG - Intergenic
1024040197 7:45547125-45547147 GAAGCAAGCAGGGGTGTTGGGGG + Intergenic
1024958580 7:54951525-54951547 TAAGCAAACAGATGTATTGGGGG + Intergenic
1026367044 7:69659119-69659141 AATGTAAACAGGGGAGTTGGAGG + Intronic
1027407130 7:77873505-77873527 GAAGCAAACAGGGGTGTGAGAGG + Intronic
1027515978 7:79142337-79142359 GAACCAAACTCAGGTGTTGGTGG - Intronic
1027664122 7:81023118-81023140 CAAGCTAAGAGGGGTGATGGAGG - Intergenic
1028043549 7:86089022-86089044 GTAGCAAACAGAGGTGTTGGTGG - Intergenic
1029804598 7:102983121-102983143 GAAGCAAAGAGGGGTGGTAGGGG + Intronic
1030191741 7:106817350-106817372 GAAGCAAAGAGGGGTGGGGAAGG - Intergenic
1030277133 7:107733664-107733686 GAAGCAAAGAGAGGTGTTGGGGG - Intergenic
1030368230 7:108670512-108670534 AAAGCAAACAGGGGTATTGGGGG - Intergenic
1031236534 7:119185558-119185580 GAAGCAAACAGGGGTGTAGTGGG - Intergenic
1031474757 7:122207785-122207807 GAAGAAAACAGAGGTGTTGGGGG + Intergenic
1031676252 7:124615897-124615919 GATGCAAACAAGGGCCTTGGGGG - Intergenic
1031779438 7:125942690-125942712 GAAGTAAACAGGGGTGCTCGGGG + Intergenic
1032153439 7:129449379-129449401 GAACCAAACAAAGGTGTTGAGGG + Intronic
1032478738 7:132229784-132229806 GAAGCAGACAGGTGTGGTGTGGG + Intronic
1032536678 7:132670200-132670222 GAAGCAAACAGTGATGCTGAAGG + Intronic
1033075890 7:138250264-138250286 GAAGAAAACTGGGGTGTTGGGGG - Intergenic
1033107158 7:138537361-138537383 AAAACAAACAGGGGTGGCGGAGG - Intronic
1034101505 7:148454606-148454628 GAAGCTAACAGGTGTATAGGTGG + Intergenic
1036166476 8:6438851-6438873 GAAGGAAAACGGGGTGTGGGGGG + Intronic
1036522093 8:9501271-9501293 GAAGCCAGCAGTGGTGGTGGAGG + Intergenic
1036800047 8:11784085-11784107 GAAGCAATCAGGCAGGTTGGTGG + Intronic
1037801171 8:22036778-22036800 GAATGCAACAGGGGTGTTGCGGG + Exonic
1038266014 8:26040545-26040567 GAAACAAACTGGGGGGTTTGGGG + Intronic
1039330300 8:36530423-36530445 GAAGAAAACAAGAGTGTTGGGGG - Intergenic
1041390704 8:57345001-57345023 GAAATACACAGGAGTGTTGGGGG - Intergenic
1041985869 8:63922040-63922062 GAAGCAAATAGGGGTGTTGGGGG - Intergenic
1042001379 8:64126415-64126437 GAAGCAAACAGGGCTGTTGGGGG + Intergenic
1042067939 8:64899537-64899559 GAAGAAAAAAGGGGTGCTGTGGG - Intergenic
1042335610 8:67627236-67627258 GAAACAAACAGGGCATTTGGGGG - Intronic
1043257693 8:78156940-78156962 AAAGCAAACAGGGGTGTTGTGGG - Intergenic
1043260279 8:78186597-78186619 AGAACAAACAGGGGTGTTTGGGG + Intergenic
1044286291 8:90414894-90414916 GAAGCAAACAGGGGTGGTGGGGG + Intergenic
1044487478 8:92769595-92769617 GAAGCAAACAAAGGTGTTGGGGG + Intergenic
1044633750 8:94302255-94302277 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1044943682 8:97369950-97369972 GAGGAAAAAAAGGGTGTTGGGGG - Intergenic
1045221443 8:100204215-100204237 GAAGCAAACAAGGTTGTTGGGGG - Intronic
1045295839 8:100871147-100871169 GAAGCTTACACGGCTGTTGGGGG + Intergenic
1045648652 8:104323359-104323381 GCAGAAAGCAGGGGAGTTGGAGG - Intergenic
1045897552 8:107237431-107237453 CAGGCAAAATGGGGTGTTGGGGG + Intergenic
1046586097 8:116150072-116150094 GAAGCAAACAGAGATGTTGGGGG + Intergenic
1047285937 8:123487255-123487277 GGAGCTTACATGGGTGTTGGGGG + Intergenic
1047732955 8:127741472-127741494 AAAACAAACAGGGATGGTGGTGG - Intergenic
1047970082 8:130077058-130077080 GAAGGGAATGGGGGTGTTGGCGG + Intronic
1048084203 8:131159594-131159616 GAAGCAAACAGGGGTGTTGAGGG + Intergenic
1048457740 8:134593118-134593140 GAGGCAGCCAGGGGTGGTGGAGG - Intronic
1048654671 8:136522669-136522691 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1050863756 9:10470799-10470821 AAAGGAAACAGGAGTGGTGGAGG + Intronic
1052101273 9:24448707-24448729 GAAGCAAAGAGGCATGATGGGGG + Intergenic
1052227292 9:26105928-26105950 GAAGCAAACAGAGGTCTTAGGGG - Intronic
1052368313 9:27638387-27638409 GGAGCAAACAGGGGTGTTGGGGG - Intergenic
1055165445 9:73185721-73185743 GCAGTATACATGGGTGTTGGTGG - Intergenic
1056314560 9:85375394-85375416 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1056377930 9:86032515-86032537 AAAACAAACAAGTGTGTTGGAGG + Intronic
1057316260 9:93970687-93970709 GAAGCAAACAGGGATGTTGGGGG - Intergenic
1057411030 9:94816670-94816692 GAAGAAGACTGGGGAGTTGGAGG + Intronic
1058259559 9:102812119-102812141 GAAGAAAACAAAGGTGTTGGGGG + Intergenic
1059972009 9:119677879-119677901 TGAGGAAACAGGGGTGTGGGTGG + Intergenic
1060103636 9:120860314-120860336 GAAACAGACAGGTGTGGTGGTGG - Intronic
1061322852 9:129842326-129842348 GTAGGAAACAGAGGTGCTGGTGG + Intronic
1062138232 9:134940917-134940939 AAAGCAAAGTGGGGTGGTGGTGG + Intergenic
1062454968 9:136631729-136631751 GGAGCAAACCGGGGGCTTGGCGG - Intergenic
1062457657 9:136647027-136647049 GGAGCAGCCAGGGGTGTTTGTGG - Intergenic
1185609020 X:1383315-1383337 AAAACAAACAGGGGTGGTGGGGG - Intergenic
1185940934 X:4318202-4318224 GAAGGAAACAGGCTTGTTAGTGG - Intergenic
1186279315 X:7975710-7975732 GAAGCAAACAGGGGTGTTAGGGG - Intergenic
1186470112 X:9814528-9814550 GAAGCAAACAGGGGTGTCGGGGG + Intronic
1187022457 X:15398386-15398408 TAAGAGAACAGGGGTGATGGGGG + Intronic
1188599531 X:31944625-31944647 CAAACAAACAGGAGTGGTGGCGG - Intronic
1189105922 X:38235181-38235203 GAAGCATCCAGAGATGTTGGAGG - Intronic
1189281949 X:39825187-39825209 GGAGCACACAGGGGAGTTCGAGG + Intergenic
1189501236 X:41561000-41561022 CAAGCAGACAGAGGTGTTTGGGG - Intronic
1189630026 X:42942999-42943021 GAAGCAAAGAGAGGTGGTGGGGG + Intergenic
1190091966 X:47446477-47446499 AAGGAAAGCAGGGGTGTTGGTGG + Exonic
1190538083 X:51448779-51448801 GAAGCAAAAAGGGGTGGTAAAGG - Intergenic
1190809484 X:53869550-53869572 GAAGCAAAGAGGGGTGGTGGTGG - Intergenic
1191142095 X:57125569-57125591 GAGGCAAACAGGGCATTTGGTGG - Intergenic
1191226389 X:58048849-58048871 GAAGCAAACAGGGGTGTTGGAGG - Intergenic
1191630414 X:63315657-63315679 GAATCAAACAGTGGTGTTGGAGG + Intergenic
1191659129 X:63632437-63632459 GAAGCAAACAGGGATGTTGTGGG + Intergenic
1191719560 X:64218108-64218130 GAAGCAAACAGCGGTGTTGCGGG + Intergenic
1191742845 X:64453749-64453771 GAAGCAAAGAGGGGTGTTGGAGG + Intergenic
1191759046 X:64627462-64627484 GAAGCAAACAGAGGTTTTGGGGG - Intergenic
1191769808 X:64742546-64742568 GAAGCAAATAGAGGTGTTGGTGG + Intergenic
1191941550 X:66486306-66486328 GAAGCAAACAGGGATGTTGTAGG + Intergenic
1191945941 X:66535460-66535482 GAAGCAAATAGAGGTGTTGGCGG - Intergenic
1192298036 X:69870438-69870460 GAGGCAAACAGAGATGTTGGGGG + Intronic
1192661879 X:73050207-73050229 GAAGCAAACAGAGGTGTTGGGGG + Intergenic
1192673559 X:73170827-73170849 GAAGCAAACAGGGGAGTTGAGGG + Intergenic
1192940787 X:75909671-75909693 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1193053117 X:77122730-77122752 GAAGCAAACAGGGATGATGGGGG - Intergenic
1193155958 X:78174469-78174491 GAAGCAAACAGGGATGTTGGGGG + Intergenic
1193297478 X:79850249-79850271 GAAGCAAACATGGGTGTAGGGGG - Intergenic
1193531595 X:82660858-82660880 TAAGCAAAGAGGGATGGTGGGGG + Intergenic
1193832626 X:86307670-86307692 GAAGCAAACAGAGGTGTTGGGGG - Intronic
1193876971 X:86872852-86872874 GAAGCAAACAGGGTTGTTGGGGG - Intergenic
1193904283 X:87224108-87224130 GAAGCAAACAGAGGTTTTAGGGG - Intergenic
1193978934 X:88157762-88157784 GGAGGCAACAGGGGTGTTGAGGG - Intergenic
1194032317 X:88832305-88832327 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1194179902 X:90698406-90698428 GAAGCACACAAGGGTGTTCGGGG + Intergenic
1194343000 X:92728660-92728682 GATGCAAACAGGGGTGTTGGGGG - Intergenic
1194513720 X:94824690-94824712 GAAGTAAACAAGGGTATTGTGGG + Intergenic
1194604714 X:95964434-95964456 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1194771542 X:97912801-97912823 AAAGCAAACATTGGTGTTTGGGG + Intergenic
1194833619 X:98656353-98656375 GAAGCAAACAGGGGTGTTGGGGG - Intergenic
1194870539 X:99126032-99126054 GAAGCAAAGAGGAGTGATAGAGG - Intergenic
1195070352 X:101273218-101273240 GAAGCAAAGAGGCTGGTTGGGGG - Intronic
1195749172 X:108147125-108147147 GAAGCAAACAGGGGTGTTGGGGG + Intronic
1195782690 X:108482320-108482342 GAAGCAAATGGAGGTGTTGGGGG + Intronic
1195809981 X:108818277-108818299 GAAGCAAACAGGGTTGTTGGGGG + Intergenic
1196275504 X:113761668-113761690 AAAGCAAACAGGGGTGTTGGGGG - Intergenic
1196528683 X:116758153-116758175 GAAGCAAAGAGGGGTGATGAAGG - Intergenic
1197001984 X:121450602-121450624 GAAGCAAACAGAGGTGTTGGGGG - Intergenic
1197074369 X:122337348-122337370 GAAGCAAACAGGGGTGTTGGGGG + Intergenic
1197084508 X:122455951-122455973 GAAGCAAACAAGGGTGTTGGGGG + Intergenic
1197097154 X:122610392-122610414 GAAGCAAACTGGGCTGTTGGGGG - Intergenic
1197245425 X:124161765-124161787 GAAGCAAATAGGGGTGTTGGGGG + Intronic
1197387121 X:125815122-125815144 GAAGCAAACAGAGGTGTTGGGGG + Intergenic
1197404775 X:126036739-126036761 GAAGCAAACAGAGATGTTGGGGG - Intergenic
1197409534 X:126098281-126098303 GAATCAAACAGGGGTTTTGTGGG + Intergenic
1197426052 X:126298061-126298083 GAATCAAACAGGGGTATTGAGGG + Intergenic
1197477678 X:126943776-126943798 AAAGCAAACAGGGGTGTTGGGGG + Intergenic
1197497784 X:127207421-127207443 GAAGCCAACAGGGGTTTGCGGGG + Intergenic
1197537314 X:127706818-127706840 GAAGCAAAGAGGGGTGGTGGGGG - Intergenic
1197554584 X:127938000-127938022 GAAGCAAACAGGGATGTTGGGGG + Intergenic
1197591541 X:128416897-128416919 GAAGCAAACAGAGGTGTTCGGGG - Intergenic
1197956234 X:131951425-131951447 GAAGAAAACAGGAGTGTCGGGGG - Intergenic
1198169724 X:134093816-134093838 GAAGCAAAGAAGGGTGGTGGGGG - Intergenic
1198651092 X:138864536-138864558 GAAGCAAAAAGGGGAGGTTGGGG + Intronic
1198700926 X:139397450-139397472 GAAGTAAACAGGGGTGTTGAGGG - Intergenic
1198783356 X:140260244-140260266 GAAGCAAACAGCGGTGTTGGGGG + Intergenic
1199275746 X:145940026-145940048 TAAAAAAACAGGGGGGTTGGGGG - Intergenic
1200455314 Y:3383392-3383414 GAAGCAAAGAGGGCTGCTGAAGG - Intergenic
1200520980 Y:4209596-4209618 GAAGCAAACAGGGGTGTTTGGGG - Intergenic
1200526558 Y:4280575-4280597 GAAGCACACAAGGGTGTTCGGGG + Intergenic
1200651361 Y:5845326-5845348 GATGCAAACAGGGGTGTTGGGGG - Intergenic
1201400285 Y:13597442-13597464 GAAGCAAAGAGGGTTGTTGAAGG + Intergenic
1201529932 Y:14980460-14980482 GAAGCAAACAGAGGTGTTGGGGG + Intergenic
1201798160 Y:17924262-17924284 GAACCAAACAGAGATGTTGGGGG - Intergenic
1201803393 Y:17981695-17981717 GAACCAAACAGAGATGTTGGGGG + Intergenic
1202100136 Y:21298988-21299010 GAAGCAAACAGGGGTGTTCAGGG - Intergenic
1202359485 Y:24092953-24092975 GAACCAAACAGAGATGTTGGGGG - Intergenic
1202511293 Y:25577161-25577183 GAACCAAACAGAGATGTTGGGGG + Intergenic