ID: 1177991386

View in Genome Browser
Species Human (GRCh38)
Location 21:28039606-28039628
Sequence GCAAACAGGGGTGTTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 60, 1: 109, 2: 122, 3: 111, 4: 427}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991374_1177991386 24 Left 1177991374 21:28039559-28039581 CCTTAGGGGGGGCCAACTGGGAC No data
Right 1177991386 21:28039606-28039628 GCAAACAGGGGTGTTGGGGGTGG 0: 60
1: 109
2: 122
3: 111
4: 427
1177991373_1177991386 25 Left 1177991373 21:28039558-28039580 CCCTTAGGGGGGGCCAACTGGGA No data
Right 1177991386 21:28039606-28039628 GCAAACAGGGGTGTTGGGGGTGG 0: 60
1: 109
2: 122
3: 111
4: 427
1177991371_1177991386 26 Left 1177991371 21:28039557-28039579 CCCCTTAGGGGGGGCCAACTGGG No data
Right 1177991386 21:28039606-28039628 GCAAACAGGGGTGTTGGGGGTGG 0: 60
1: 109
2: 122
3: 111
4: 427
1177991369_1177991386 29 Left 1177991369 21:28039554-28039576 CCTCCCCTTAGGGGGGGCCAACT No data
Right 1177991386 21:28039606-28039628 GCAAACAGGGGTGTTGGGGGTGG 0: 60
1: 109
2: 122
3: 111
4: 427
1177991375_1177991386 12 Left 1177991375 21:28039571-28039593 CCAACTGGGACTTTAGACTAGTT No data
Right 1177991386 21:28039606-28039628 GCAAACAGGGGTGTTGGGGGTGG 0: 60
1: 109
2: 122
3: 111
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991386 Original CRISPR GCAAACAGGGGTGTTGGGGG TGG Intergenic
900131299 1:1088343-1088365 GCAGATGGGGGTCTTGGGGGAGG - Intronic
900350708 1:2233220-2233242 TCCAACAGGGCTGGTGGGGGGGG + Intronic
900794889 1:4701926-4701948 GCATGGCGGGGTGTTGGGGGAGG - Intronic
902080590 1:13818068-13818090 ACAAGCAGGGCTGTGGGGGGTGG - Intronic
902237354 1:15065913-15065935 GCACACATGGGTGCTGGGTGTGG + Intronic
902621249 1:17652223-17652245 GGGATCAGGGGTGTTGGGGCAGG + Intronic
902796145 1:18801503-18801525 GCTGACAGTGGTGTTGGTGGTGG - Intergenic
903066780 1:20704135-20704157 GCAGACGGGGGTGTGGTGGGGGG + Intronic
903466702 1:23556968-23556990 GCCACCAGGGGTGTGGGGGAAGG + Intergenic
903473038 1:23600621-23600643 GCAAGCAGGAGGGTTGGGTGTGG - Intronic
904522284 1:31104998-31105020 GCAAACAGAGGGGCTGGGTGCGG - Intergenic
904941486 1:34166948-34166970 GCATACAAGCGTGTTGGGGGTGG - Intronic
905269334 1:36776813-36776835 GCAGGCAGGGGTTTGGGGGGCGG + Intergenic
905353750 1:37366355-37366377 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
905464890 1:38145679-38145701 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
905616923 1:39408189-39408211 AGAAAATGGGGTGTTGGGGGAGG - Intronic
906399023 1:45491182-45491204 CCCAGCAGGGGGGTTGGGGGCGG + Intergenic
906465447 1:46074541-46074563 GCAAAGAGGTGTGGTGGGGGTGG + Intronic
906679009 1:47712325-47712347 GGAAACAGGGGTGAAGGGGATGG + Intergenic
906867766 1:49441089-49441111 GCTAACAGGGGTGTTGTGGCGGG - Intronic
907118589 1:51990221-51990243 GGAAACGGGGGCGTGGGGGGCGG - Intronic
907780013 1:57558353-57558375 GCAAACAGGGATGTTGTGGGTGG - Intronic
908616569 1:65929137-65929159 GCAAACAGGCAGGTTGGGGGTGG + Intronic
909172927 1:72317875-72317897 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
909576585 1:77183447-77183469 GCAAACAGGGGTGTTGGAGGTGG - Intronic
909810692 1:79929147-79929169 GCAAACAGGTGTGTTGTGGGTGG - Intergenic
910561534 1:88597263-88597285 GCAAATAGGAGTATTGGGGGTGG - Intergenic
910587882 1:88899309-88899331 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
910639293 1:89442386-89442408 GCAAACAGGTGTGTTGGGAGAGG + Intergenic
910790005 1:91041421-91041443 GCAAACAGGGGTATTGGGGGTGG - Intergenic
910831479 1:91466135-91466157 GCAAACTCGGGTGTTGAGGGTGG + Intergenic
911808508 1:102243102-102243124 GAAAACAGAAGGGTTGGGGGAGG + Intergenic
911883251 1:103268051-103268073 GCAAATAGGGGTGTTGGGGGTGG - Intergenic
911980150 1:104557246-104557268 GGAAACAGGGGTGTTGGGGGTGG - Intergenic
912050985 1:105527367-105527389 ACAAACAGGGGTGTTGGGGATGG + Intergenic
912066709 1:105754177-105754199 GAAAACAGAGGTGTTGGTAGTGG - Intergenic
912252157 1:108022231-108022253 GCAAACAGGGATGTTGGGGGTGG + Intergenic
912733648 1:112131245-112131267 GCAAATAGGGGTGTTGGGGGAGG + Intergenic
912842392 1:113050663-113050685 GCAAACAGGGTTGGTGGGTGGGG + Intergenic
912944145 1:114070595-114070617 GGAAACAGGGGTGTTGGGGGTGG + Intergenic
915214478 1:154330682-154330704 GCAAACACAGGTGTGGGAGGGGG - Intronic
915594044 1:156886342-156886364 GCTCACGGGGGTGTTGGGAGGGG + Intergenic
915667990 1:157462075-157462097 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
915737209 1:158092672-158092694 GCCAGCAAGGGGGTTGGGGGTGG + Intronic
916106660 1:161437720-161437742 GCAAACAGAGGTGTTGGGAGTGG + Intergenic
916200927 1:162271170-162271192 TCATACTGGGGTGTTGGGGGAGG - Intronic
916306160 1:163335598-163335620 GCGGGCAGGGGTGTAGGGGGAGG - Intronic
916681479 1:167109073-167109095 GCAGCCAGGGGTATTGGGGAAGG + Intronic
917020682 1:170583048-170583070 GAGGACAGGGGTTTTGGGGGTGG - Intergenic
917282878 1:173396041-173396063 GCAAAGAGAGGTGGTGAGGGTGG - Intergenic
917462404 1:175243794-175243816 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
918756034 1:188340217-188340239 GAAAACAGGAGTGTTGGGGGTGG + Intergenic
918814790 1:189168812-189168834 GCAAACAGGAGCGTTGGGGCTGG - Intergenic
918906492 1:190503120-190503142 GCGGAGGGGGGTGTTGGGGGCGG - Intergenic
918907155 1:190511627-190511649 GCAAAAAGGGGTATTTGGGATGG - Intergenic
918918525 1:190674256-190674278 GTGAACAGGGATGTTGGGGATGG + Intergenic
918957950 1:191235605-191235627 GCAAAGAGAGGTGTTGGGGGTGG - Intergenic
919124974 1:193382566-193382588 GCAATAAGGGGTGTTGGGGGTGG + Intergenic
919230326 1:194764981-194765003 GCAATCAGGTGTGTTTGGGGTGG + Intergenic
919241486 1:194922079-194922101 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
919688038 1:200502740-200502762 GGAAGCAGGAGTGTTGGGGGTGG - Intergenic
920054540 1:203182675-203182697 GGAAACAGGAGTGTTGGCAGAGG + Intronic
920565851 1:206972440-206972462 GCAAACTGGGGGATTGGAGGTGG - Intergenic
920712988 1:208313087-208313109 CCAAAAAGGGGTGATGGTGGGGG + Intergenic
920732773 1:208503392-208503414 GCAAGGAGGGGAGTTGGTGGGGG + Intergenic
922576036 1:226661140-226661162 CCAAGAAGGTGTGTTGGGGGTGG - Intronic
922643594 1:227261843-227261865 GCAACCTAGGGTGTTGGTGGGGG + Intronic
923091984 1:230747775-230747797 GGAAACAGGGGTGCTGGGGAGGG + Intronic
924573435 1:245258464-245258486 GCAAACAGTGGTGTTGGTATTGG + Intronic
924841067 1:247709967-247709989 GTAAACAGAGGCATTGGGGGTGG + Intergenic
1062770807 10:99100-99122 GCAAACAAGGGTGTTGCAGGTGG + Intergenic
1063019115 10:2108376-2108398 ACAAACAGGGGTGATGAGGCTGG + Intergenic
1063121716 10:3109398-3109420 GCAAGCTGGGGTGTCCGGGGTGG - Exonic
1064517975 10:16170657-16170679 GCAAACAGGGGTGTTAGGGGTGG + Intergenic
1064629615 10:17296455-17296477 GCACACTGGGGAGTTGAGGGAGG + Intergenic
1066167346 10:32801678-32801700 GCAAACAGGGGTGTTGGGAGTGG + Intronic
1066169403 10:32826134-32826156 GCAAACAGGGATGTTGGAGGTGG - Intronic
1066543403 10:36474041-36474063 GGAAACATGGGTGTTGGGAGTGG - Intergenic
1067146054 10:43694727-43694749 GCAAACAGAGGGGCTGGAGGAGG + Intergenic
1067332828 10:45337795-45337817 GCAGACAGGGGTGTTGGGGGTGG - Intergenic
1067716298 10:48693330-48693352 GCAAGCAGAGGTGTTGGTGCCGG + Intronic
1068225664 10:54104047-54104069 GCAAACAGGAGTGTTGGGGCTGG + Intronic
1068446890 10:57136161-57136183 GCAAACGGGGGTGTTGAGGGTGG - Intergenic
1068649409 10:59504839-59504861 GTTACCAGGGGTGTGGGGGGAGG - Intergenic
1069192632 10:65508777-65508799 GCAAACAGGAGTGTTAGAGGTGG + Intergenic
1069566084 10:69464386-69464408 GAGAACAGAGGGGTTGGGGGAGG + Intronic
1069608742 10:69758038-69758060 GCAGACAGGGGTGCTGGTGGCGG - Intergenic
1069791099 10:71021510-71021532 GCAAACAGGGGTATTGGGGATGG + Intergenic
1069791185 10:71022162-71022184 GCAAATAAGGGTGTTGGGCGTGG + Intergenic
1070051653 10:72895535-72895557 GCAAAGTGGGGTGATGAGGGAGG + Intronic
1070783574 10:79150739-79150761 GCAGACAGGGGTGGATGGGGAGG - Intronic
1070829155 10:79408085-79408107 GCAAACATCGGTGGTGGAGGTGG - Intronic
1071267413 10:83976416-83976438 GCAAACAGGGGTGTTTGGGGTGG + Intergenic
1071741623 10:88365018-88365040 GCAAAAAGGGGGGTGGGGAGAGG - Intronic
1071943101 10:90610198-90610220 GCAAACAGGGGTGTTGAGGGTGG + Intergenic
1072209586 10:93234113-93234135 GCAAACAGAGGTGTTGAGGGTGG + Intergenic
1072305892 10:94106956-94106978 GGAGAAAAGGGTGTTGGGGGGGG - Intronic
1072360157 10:94651725-94651747 GCAAACAGGAGTGTTGGGGGTGG - Intergenic
1072417662 10:95262599-95262621 GTAAACAAGGGTGCTGGGTGGGG - Intronic
1073059602 10:100725474-100725496 GAAAATATGTGTGTTGGGGGAGG - Intergenic
1073150221 10:101306230-101306252 CCAATGAGGGGAGTTGGGGGTGG + Intergenic
1073557007 10:104463480-104463502 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1073656984 10:105426732-105426754 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1073830763 10:107380395-107380417 GCAAAGATGGGTGTTGGGAGTGG + Intergenic
1073854775 10:107661758-107661780 TTAAACAGGGGTGTTGGGTGTGG - Intergenic
1074105821 10:110389014-110389036 GGGAAAGGGGGTGTTGGGGGAGG + Intergenic
1074244625 10:111676441-111676463 GCAAACAGGGATGTTGGGGGTGG - Intergenic
1074345439 10:112680906-112680928 GCAAACAGTGGTGATGGTGTTGG + Intronic
1074870785 10:117574408-117574430 GGAACCAGGGGTTTTGGGGCGGG + Intergenic
1074907761 10:117880054-117880076 TAAAACAGGTGTGTTTGGGGAGG + Intergenic
1075606550 10:123815693-123815715 GGAAACAGGGGTGTTGGGGGTGG - Intronic
1076122831 10:127950024-127950046 GGAAAGAGGGTTGGTGGGGGCGG - Intronic
1076239314 10:128891937-128891959 GGAAACTTGGGGGTTGGGGGAGG + Intergenic
1076370291 10:129948616-129948638 GGAAACTGGGGGGTGGGGGGAGG + Intronic
1077049627 11:560901-560923 GCCAATAGGGGTGCTAGGGGCGG + Intronic
1077719152 11:4609556-4609578 GCAATCAGGGTAGCTGGGGGTGG + Intergenic
1077917512 11:6621236-6621258 GCACAGAGGGGTGGTGGGGTGGG - Intergenic
1077940742 11:6839297-6839319 GAAAACAGGGGTGCTGGGTATGG - Intergenic
1078430099 11:11281802-11281824 GCCAAGAGTGGGGTTGGGGGAGG + Intronic
1078922150 11:15840889-15840911 CAAAACAGGGGTGATGGGGTTGG + Intergenic
1079035542 11:17016200-17016222 ACAGACAGTGGTGTTGGGGAAGG + Intergenic
1079090150 11:17475212-17475234 GTAAAAAGGTGTGGTGGGGGAGG - Intronic
1079269658 11:18972282-18972304 GCTGACAGGTGTGTGGGGGGAGG + Intergenic
1080324095 11:31050142-31050164 GGACTCAGGGCTGTTGGGGGTGG + Intronic
1080976523 11:37349414-37349436 ACAAACAGGGGTGTTGGGGGTGG - Intergenic
1081072472 11:38628670-38628692 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
1081110141 11:39125953-39125975 GCAAACAGGGGTGTTGGAGGTGG - Intergenic
1081590059 11:44416369-44416391 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
1081608711 11:44545414-44545436 GCAAACAGAGGTGTTGGAGGTGG - Intergenic
1082032999 11:47620125-47620147 AAAAACAGGGGTGAGGGGGGAGG + Intronic
1082671376 11:56040612-56040634 GTAAACAGGAGTGTCTGGGGTGG - Intergenic
1082999303 11:59277110-59277132 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
1083092834 11:60218675-60218697 GCAAACAGGGGCCTTGGGAGTGG - Intronic
1083871110 11:65489094-65489116 ACAAACAGTGGGGGTGGGGGTGG + Intergenic
1083925177 11:65801721-65801743 GAGAGCTGGGGTGTTGGGGGAGG - Intergenic
1084102168 11:66957095-66957117 GCAAACACTTGTGCTGGGGGTGG - Intronic
1084212864 11:67631851-67631873 CCAAGCAGGGGTCTTGGAGGTGG + Exonic
1085348623 11:75784048-75784070 GGAATCAGTGGTGTTGGGGGTGG + Intronic
1085747253 11:79125806-79125828 GCAAACAGGGGTGTTGGGGGTGG - Intronic
1086141673 11:83506513-83506535 GCAAATAGGGGTGTTGGAGGTGG + Intronic
1086278309 11:85158029-85158051 GCAAACAGGGCTGTTGGGGGTGG - Intronic
1086761181 11:90633821-90633843 GAAAATGGGGGTGGTGGGGGGGG - Intergenic
1086833807 11:91597956-91597978 GCAAACAGCATTGTTGGGGGTGG - Intergenic
1086961877 11:92986275-92986297 GCAAACAGAGGTGCTGGGGGTGG + Intergenic
1088449027 11:109962908-109962930 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1089308019 11:117538819-117538841 GGAAACTGGGGGTTTGGGGGAGG + Intronic
1089399037 11:118153725-118153747 GAAAACAGGAGAGTTGGAGGAGG - Intergenic
1089627575 11:119761433-119761455 GCAGACAGAGGTGGTGGGAGGGG - Intergenic
1089902419 11:122001228-122001250 GTCTACAGGGGTATTGGGGGAGG - Intergenic
1090900397 11:131025920-131025942 GCAAAAGTGGGTGTTGGGGAGGG - Intergenic
1091212148 11:133871301-133871323 GAAAAAAGGGGTGGTGGGGATGG - Intergenic
1091220759 11:133928674-133928696 TCAAACAGGAGTGTAGGGAGGGG + Intronic
1092092945 12:5819192-5819214 GCAAACAGGGGTGTTGGGGGTGG - Intronic
1092315297 12:7406285-7406307 GTAAAATGGTGTGTTGGGGGTGG + Intronic
1092656455 12:10689954-10689976 GAAAATAAGGGTGTTGAGGGTGG + Intergenic
1093049241 12:14487397-14487419 GCAAAGAGAGGTGTTTGGAGGGG + Intronic
1093049976 12:14493395-14493417 GCAAAGAGAGGTGTTTGGAGTGG + Intronic
1093964229 12:25308506-25308528 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1094102217 12:26776825-26776847 GCAAACAGGGGTGTTGAGGATGG - Intronic
1095279618 12:40334984-40335006 TCAAACTGGGGTGGTGGAGGTGG - Exonic
1095377053 12:41542552-41542574 GGAAACGTGTGTGTTGGGGGTGG - Intronic
1095557457 12:43523867-43523889 GCTACCAGGGTGGTTGGGGGAGG - Intronic
1095856549 12:46866107-46866129 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1095923592 12:47556247-47556269 GCAAACAGGGGTTTTTATGGGGG + Intergenic
1095947907 12:47764330-47764352 GCAAAGAGGGGAGTGGTGGGAGG - Intronic
1096243482 12:49971903-49971925 GAGAACATGGGGGTTGGGGGGGG + Intronic
1096457855 12:51802168-51802190 ACAAACAGGGGTGTTGGGGGTGG + Intronic
1096495599 12:52037552-52037574 GGAAACTGGGGAGTCGGGGGGGG + Intronic
1096538128 12:52288301-52288323 GCAGAGAGGAGAGTTGGGGGTGG - Intronic
1096588995 12:52644737-52644759 GCAAAGAGGCATGGTGGGGGCGG + Exonic
1096673981 12:53216669-53216691 GTAAACAGGACTGATGGGGGAGG + Intronic
1097076538 12:56399052-56399074 GCAAATAGGGGTGTTGGGGTGGG - Intergenic
1097431826 12:59518657-59518679 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1097821757 12:64134948-64134970 GCAAACAGAAGTGTTGGAGGTGG + Intronic
1097840838 12:64319956-64319978 GCAAACAGGAGTGGTGGACGGGG - Intronic
1098489989 12:71064388-71064410 GGAATCAGGGATGTTGGGGAGGG - Intronic
1098715727 12:73827003-73827025 GCAAACAGGGGTGTTGGGGATGG - Intergenic
1098730750 12:74034928-74034950 GCAAACAGGGGTATTGAGGGTGG - Intergenic
1098749517 12:74277054-74277076 ACAAACAGGGGTGTTGGGGATGG - Intergenic
1098805135 12:75013637-75013659 GAAAACAGGGGTGTTGGGGGTGG - Intergenic
1099184109 12:79499109-79499131 GCAAACAGGGGTGCTGTGGGTGG + Intergenic
1099350701 12:81565270-81565292 GCAAACAGGAGTGTTGGGGGTGG - Intronic
1099375328 12:81891533-81891555 GCAAACAGGGATGTTGGGGGTGG - Intergenic
1099379982 12:81941179-81941201 GCAAACAGGTGTGTTGGGGGTGG + Intergenic
1099526064 12:83720711-83720733 GCAAACAGGGATTTTGGGCATGG - Intergenic
1099735458 12:86562618-86562640 GCAAACAGAGGTGTTGGGGATGG - Intronic
1099859715 12:88211058-88211080 GCAAACAGAGGTGTTGGGTGTGG + Intergenic
1100083000 12:90875797-90875819 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1100161712 12:91868155-91868177 GCAAACAGGTGTTTTTTGGGGGG - Intergenic
1100241498 12:92714131-92714153 GCAAACAAGGTTGTTGGGGGTGG + Intergenic
1101431667 12:104632267-104632289 GCAAGCAGAGGTGTAGTGGGGGG + Intronic
1101535008 12:105608548-105608570 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1101542764 12:105680212-105680234 GCAAACACGGGTGTTGGTGTTGG - Intergenic
1103008589 12:117440367-117440389 GCCACCAGGTGTGTTGGGGCAGG + Intronic
1103035235 12:117651291-117651313 GCAAACAGGGGTATTGGGGGTGG - Intronic
1103396185 12:120609009-120609031 GCAAACAGGGGTGTTGGTGGTGG - Intergenic
1103986818 12:124772884-124772906 GCAAGCAGGAGTGATGGGGGAGG + Intergenic
1104924413 12:132306420-132306442 GCAGAGAGGCCTGTTGGGGGTGG + Intronic
1105788081 13:23769560-23769582 GGAAGCAGGTGTGTGGGGGGAGG + Intronic
1106205909 13:27594369-27594391 GCAAACAGGAGGCTTGGGAGAGG - Intronic
1107153309 13:37137797-37137819 GTAAACAGTGGTGCTGGGAGGGG - Intergenic
1107424731 13:40281636-40281658 GCAAGCAGGGGTGTTGGGGGTGG + Intergenic
1107812723 13:44215691-44215713 CCACACTGGGGAGTTGGGGGAGG + Intergenic
1107899636 13:44998923-44998945 GCAAACAGGGGAGTTGGTCCTGG + Intronic
1108688831 13:52845360-52845382 GCAAACAGTGGTGAAGGGGAGGG + Intronic
1108903930 13:55447247-55447269 GCAAACAGGGGTTTTGCAGGTGG - Intergenic
1108914609 13:55591335-55591357 GCAAACAGGGGTTTTGGGGGTGG + Intergenic
1109406168 13:61903169-61903191 GCAAACAGGGGACATGAGGGTGG - Intergenic
1109582736 13:64363702-64363724 GCAGACAGGGACGTTGGGGGTGG - Intergenic
1109951333 13:69504601-69504623 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
1111016500 13:82388263-82388285 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
1111432494 13:88162034-88162056 GCAAAAAGGGGTGGTGGAGATGG + Intergenic
1111576071 13:90155202-90155224 GCCAACAGGGGTTTGGGGGGTGG + Intergenic
1112231460 13:97592594-97592616 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1114205587 14:20568663-20568685 GCAGATAGGAGTGTTAGGGGTGG - Intergenic
1114616697 14:24072255-24072277 GAAAACAGGGGAGGTGGGGAGGG + Intronic
1114758574 14:25286165-25286187 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
1116058595 14:39894502-39894524 GCAAACAGGAGTGTTGCAGGTGG - Intergenic
1116158708 14:41239110-41239132 GCAAACAGGAGAATTGGGGGTGG + Intergenic
1116248858 14:42455839-42455861 GCAAAGAGGGGTGTTGGGAGTGG - Intergenic
1116414758 14:44666874-44666896 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1116531771 14:45980638-45980660 GAAAACAGGGGTGTTAGGGGTGG + Intergenic
1117001253 14:51373849-51373871 GCAAACAGGGGTGTTAGGGGTGG - Intergenic
1117216500 14:53557665-53557687 GCAAACAGAGGTGTTGAGGGTGG - Intergenic
1117596600 14:57332332-57332354 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1117633800 14:57721951-57721973 GAAAACAGGAGTGTTGGGGGTGG - Intronic
1118643598 14:67816608-67816630 CCGAACAGCGGTGGTGGGGGTGG + Intergenic
1118881092 14:69826458-69826480 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1118950879 14:70435521-70435543 GCAAACAGGGGCATTGGGAGTGG + Intergenic
1119146309 14:72318058-72318080 GTAAAATGGGGTGTTGGGGTGGG - Intronic
1120556316 14:85932867-85932889 GGAAACAGGGGTGTTGGAGGTGG + Intergenic
1120973331 14:90228016-90228038 GCAGACAGGGGTGTTGAGGGTGG - Intergenic
1121371045 14:93358851-93358873 GTAGACAAGGGTGTTGGGGGTGG - Intronic
1121436119 14:93921331-93921353 GCAGCCAGGGGTGCTGGGGCTGG + Intronic
1121562005 14:94882819-94882841 GCAGGCAAGGGTGGTGGGGGCGG - Intergenic
1121637333 14:95462545-95462567 GGAGACAGCGGTGATGGGGGAGG - Intronic
1121955191 14:98207090-98207112 CCAACCAGGGGTGCTGGGGTTGG - Intergenic
1122415537 14:101547953-101547975 GAAAACAGCGATGGTGGGGGGGG - Intergenic
1122594241 14:102878457-102878479 GAAAGCAGAGATGTTGGGGGTGG + Intronic
1122830743 14:104394454-104394476 GCAAGCAGGACTGTTGCGGGGGG - Intergenic
1122841790 14:104468387-104468409 GCAAAGAGGGGCGGTGAGGGTGG + Intergenic
1122855646 14:104558833-104558855 GGAAACAAGGGTGGTGGGAGAGG + Intronic
1123837722 15:24212877-24212899 GCAAAAAGGAGTGGTGGGTGTGG + Intergenic
1123847254 15:24315192-24315214 GCAAAAAGGAGTGGTGGGTGTGG + Intergenic
1123866249 15:24522259-24522281 GCAAAAAGGAGTGGTGGGTGTGG + Intergenic
1125203066 15:37119304-37119326 GAAAAAAGGGGGGTTGGGGAAGG - Intergenic
1125237048 15:37526974-37526996 GCAAATAGGCTTGCTGGGGGTGG + Intergenic
1126065439 15:44822770-44822792 GTAAAATGGGGTGTTGGGGTGGG + Intergenic
1126094394 15:45077822-45077844 GTAAAATGGGGTGTTGGGGTGGG - Intergenic
1126218634 15:46186225-46186247 GGAAACAGGGGTGAAGGAGGTGG - Intergenic
1126349253 15:47727656-47727678 GCAAACTGGGGGGGTTGGGGGGG - Intronic
1127300948 15:57653089-57653111 CAAAGCAGGGGTGTTGGGGATGG + Intronic
1128635849 15:69301964-69301986 GCTCTCAGGGGTGGTGGGGGTGG + Intronic
1129152210 15:73696265-73696287 GAAAACATGGGTGGAGGGGGTGG + Intronic
1129643833 15:77411786-77411808 GTAAAGATGGGGGTTGGGGGTGG + Intronic
1129961716 15:79692499-79692521 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
1130065096 15:80596392-80596414 GAAAATAGGGGTGATGGAGGGGG + Exonic
1131304901 15:91233791-91233813 GCAAAGAGGGGTGGAGGGGTTGG - Intronic
1132467942 16:86214-86236 GCAGACAGAGGTGCTGGGGAGGG + Exonic
1134360157 16:13523607-13523629 GCAAACAAGAGCGATGGGGGAGG + Intergenic
1134784133 16:16925494-16925516 GCAAAGAGGGGTGGTGGGAGTGG + Intergenic
1134975893 16:18571056-18571078 GAAAACAGGCGAGGTGGGGGAGG - Intergenic
1136000828 16:27291449-27291471 CCAAACTGGGATGATGGGGGTGG + Intergenic
1138541403 16:57689859-57689881 GCTTCCAGGGCTGTTGGGGGAGG - Intergenic
1138868075 16:60848340-60848362 GCAAACAGGGGTGTTGAGAGTGG - Intergenic
1139256501 16:65547879-65547901 CTAACCAGTGGTGTTGGGGGTGG + Intergenic
1139485752 16:67255743-67255765 ACAAACAGGGAGGCTGGGGGAGG - Exonic
1139754445 16:69131966-69131988 GCAGAAAGGGGAGTTCGGGGTGG - Intronic
1140034803 16:71364043-71364065 AAAAACTGGGGAGTTGGGGGAGG - Intronic
1140357825 16:74321027-74321049 GGAAACTGGGGTCTTGGGGAGGG + Intergenic
1140597738 16:76436080-76436102 ACAAACAGGGGTGTTGGGGTTGG + Intronic
1141559867 16:84860469-84860491 GCAAACAGGGATGTTGGGGTTGG + Intronic
1141639663 16:85333830-85333852 GCAGGCAGGGCTGTGGGGGGAGG - Intergenic
1141678528 16:85530470-85530492 GCAGGGAGGGGTGGTGGGGGTGG + Intergenic
1141694679 16:85613846-85613868 GGAAGCGGGGGTGTGGGGGGGGG + Intronic
1141985982 16:87580311-87580333 AAAAGCAGGGGTGTTGGGGGGGG + Intergenic
1142121858 16:88390378-88390400 GCAGTCAGAGGGGTTGGGGGAGG + Intergenic
1142250949 16:88991773-88991795 GTAAACAGGGGTATTTGTGGAGG - Intergenic
1142376538 16:89709657-89709679 GCAAACACGAGTCTTGGGGATGG + Intronic
1142945931 17:3427066-3427088 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1144023046 17:11253981-11254003 CCAAACAGTGGTGTTGGGAATGG - Intronic
1144563823 17:16343763-16343785 GCGGACAGGGGAGGTGGGGGAGG - Intronic
1145242810 17:21249543-21249565 GCATCCAGGGGTGCTGAGGGAGG + Intronic
1146237875 17:31185183-31185205 GCAAACAGGGGTGTTGGGGGTGG - Intronic
1146721883 17:35129670-35129692 GAAAAGAGGGGCCTTGGGGGTGG + Intronic
1146744318 17:35314238-35314260 GGCAACAGGGGTGGAGGGGGAGG + Intergenic
1146836172 17:36112667-36112689 GCAAACAGGGGTGTTGGGTGTGG - Intergenic
1146906530 17:36621724-36621746 GGAAACAGGGGTGTCAGGGTTGG + Intergenic
1147192687 17:38747182-38747204 GCAGACAGGGGCAGTGGGGGAGG + Intronic
1147362987 17:39943198-39943220 GCAAACAGGGCTTCTGGAGGAGG + Intronic
1147704220 17:42414917-42414939 GAAAGGAGGGGTGTTGGGGAGGG - Intronic
1148455291 17:47808103-47808125 CCAAACGGTGGGGTTGGGGGTGG + Exonic
1148551407 17:48552576-48552598 GCAGAGAGGGGAGGTGGGGGGGG - Exonic
1148882314 17:50738889-50738911 GAACACGGGGGTGGTGGGGGTGG + Intronic
1149230857 17:54532409-54532431 GCCAAAAGGGGTACTGGGGGAGG - Intergenic
1149236333 17:54594684-54594706 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1149776751 17:59364283-59364305 GCAAAGTGGTGTGTCGGGGGAGG - Intronic
1150747445 17:67826582-67826604 GAAAAAAAGGGGGTTGGGGGGGG - Intronic
1150752640 17:67879752-67879774 GCAAATAGGGGAGGCGGGGGTGG + Intronic
1150959985 17:69902331-69902353 ACAAACACAGGTGTGGGGGGTGG - Intergenic
1151037939 17:70822655-70822677 GCAAACAGGAGTGTTGCGGGTGG + Intergenic
1151714329 17:75823734-75823756 GCCCTCAGGGGTGCTGGGGGTGG - Intronic
1151924810 17:77187372-77187394 GAAAAAAGGGGTGTGGGGGGGGG - Intronic
1152639716 17:81444501-81444523 GCAGCCAGGGGGGATGGGGGTGG - Exonic
1152839772 17:82559668-82559690 GCAAACAAGGGGGGTGGGTGGGG - Intronic
1153131593 18:1860131-1860153 GCAAACAGGGGTGTTGGAGGTGG + Intergenic
1154068148 18:11128694-11128716 GCAAACAGAGGTGTTGGGGGAGG - Intronic
1154496214 18:14963198-14963220 GCAGACAGGGGCCTTGGGGTAGG + Intergenic
1154505874 18:15040426-15040448 GCAAACAGGAGTGTTGGGGGTGG - Intergenic
1155288792 18:24320091-24320113 ACAAAAAGGGGGGCTGGGGGTGG + Intronic
1155573523 18:27220766-27220788 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1156192365 18:34734153-34734175 GCAAACAGAGGTATTGAGGGTGG + Intronic
1156303548 18:35856323-35856345 GCAAACAAGAGTGTTGGGGGTGG - Intergenic
1156482197 18:37443330-37443352 ATAAACAGGGGAGTGGGGGGAGG + Intronic
1156537461 18:37878086-37878108 GCAAACAGGGGTCTTGGGGGTGG - Intergenic
1156790690 18:40969903-40969925 GAAAACAGGGGTGCCGGGTGTGG + Intergenic
1156990608 18:43403142-43403164 ACAAACAGGGGTGTTAGCAGAGG + Intergenic
1156998281 18:43495274-43495296 GCAAACATGGCTATTGGCGGTGG - Intergenic
1157091166 18:44638660-44638682 CCAAGCAGGGGGGTGGGGGGGGG + Intergenic
1157476015 18:48024119-48024141 GGACACAGGGGAGTTGGGGAGGG + Intergenic
1157546327 18:48549152-48549174 GCACATAGGGGTGATGGGGGAGG + Intronic
1158258905 18:55587208-55587230 GGAGACTGGGGGGTTGGGGGTGG + Intronic
1159442187 18:68495495-68495517 GGAAAGTGGGGTGTTTGGGGAGG - Intergenic
1159559408 18:69977604-69977626 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1159911242 18:74148308-74148330 GGAAAGTGGGGTGTTGGTGGGGG - Intergenic
1160395915 18:78572233-78572255 GTAGGCAGGGGTGTGGGGGGAGG - Intergenic
1160552679 18:79705082-79705104 GCCACCAGGGCTGTTGGGTGGGG + Intronic
1160857799 19:1225114-1225136 GCAGACAGGAGTGTGGGGTGGGG + Intronic
1161261456 19:3340090-3340112 GAAGACAGGGGTGTTGGTGGAGG + Intergenic
1161525205 19:4750516-4750538 ACAAACAGGGGTGAGGGGGCCGG - Intergenic
1161901522 19:7123001-7123023 GCAACCAGGGTTCTTGGAGGAGG + Intronic
1162617510 19:11814208-11814230 CCAATCAGGGGTGCTGGGGCGGG + Intergenic
1162791043 19:13063087-13063109 GCAGAGAGAGGTGGTGGGGGAGG + Intronic
1162856048 19:13469414-13469436 GGAAACAGGTGTTTTGGAGGTGG - Intronic
1163704482 19:18804313-18804335 GCAAACAGGTGGGGTGGGGCAGG + Intergenic
1164097446 19:22024107-22024129 GCAAACAGGGGTGTTGAGGGTGG + Intergenic
1164117631 19:22237556-22237578 GCAAACAGGGGTGTTGAGGGTGG + Intergenic
1164200382 19:23013151-23013173 GCAAACATGGGTGTTGAGGTTGG + Intergenic
1164824470 19:31274382-31274404 GCAGGCAGGGGTGTTGTGGGAGG - Intergenic
1165388716 19:35526596-35526618 GGGGACAGGGGGGTTGGGGGAGG - Intronic
1165896712 19:39145804-39145826 GCAAACAGGGCGGGTGAGGGTGG - Intronic
1166309694 19:41956002-41956024 GGGAACTTGGGTGTTGGGGGGGG + Intergenic
1166355477 19:42224935-42224957 GGAGGCAGTGGTGTTGGGGGAGG - Exonic
1167247555 19:48382894-48382916 GCAACCAGTGGGGCTGGGGGTGG + Exonic
1167642755 19:50690864-50690886 GCATACAGGGGTGCTTGTGGGGG - Intronic
1167762861 19:51460379-51460401 GCAAGCATTGGTGATGGGGGTGG - Intergenic
1167882305 19:52470253-52470275 GCAAAGAAGGGTGGTGGGGGAGG - Intronic
1168183992 19:54685441-54685463 GCAAAGATGGGTAGTGGGGGCGG + Intronic
1168328341 19:55550146-55550168 GCACGCAGGTGTGGTGGGGGAGG + Intergenic
1168629564 19:57946618-57946640 ACAAACTGGGGGGTTGAGGGAGG - Intronic
925460404 2:4058032-4058054 GCAAACAAGGGTGTTGGGGTTGG - Intergenic
926282439 2:11461026-11461048 GCAAAGAGGGGTGGCGGGGTGGG + Intronic
926810714 2:16753127-16753149 GCAAACAGGGGTGGTGGGGGTGG + Intergenic
927008582 2:18878666-18878688 GCAAACGGGGATGTTGGGGGTGG - Intergenic
927081679 2:19636575-19636597 GCAAACAGAGGTCTCGGGGCAGG + Intergenic
928535453 2:32235621-32235643 GAACAAAGGGGTGTTAGGGGAGG + Intronic
928666229 2:33553067-33553089 TCAAGCAAGGGTGCTGGGGGTGG - Intronic
929270157 2:39963223-39963245 GCAAACAGGGGTGTTGGAGATGG + Intergenic
929270241 2:39963992-39964014 GCAAACAGGGGTGTTGGAGATGG - Intergenic
930001446 2:46864355-46864377 GCAAACACGGGGGATAGGGGTGG + Intergenic
930295468 2:49547992-49548014 GCAAACAGGGATATTAGGGGTGG + Intergenic
930456585 2:51614205-51614227 GCAAAAAGGGGTGTTGGGGGTGG + Intergenic
930536909 2:52654702-52654724 TCAAACAGGGATGTTGGAGATGG + Intergenic
930872729 2:56184526-56184548 GCGCACAGGGGTGTGGGCGGAGG + Exonic
930903196 2:56533135-56533157 GCAAAGAAGGGTGGTGGGGTGGG + Intergenic
931017799 2:58006001-58006023 GCAAAGAGAGGTGGTGGGGTGGG - Intronic
931661732 2:64571258-64571280 AGAAACAGGGGGGTGGGGGGCGG - Intronic
932466221 2:71925947-71925969 GCCAGCAGGGGTGGTGGGGATGG + Intergenic
932870797 2:75395835-75395857 GCAAACAAAGGTGTTGGGGATGG + Intergenic
935183730 2:100713362-100713384 GCAAAAAGGGGTGTTGGGGTTGG - Intergenic
935425422 2:102913768-102913790 GCAAACAGAGGTGTCGGGGGTGG + Intergenic
935564635 2:104592676-104592698 GCAAACACGGGTGTTGTGGGTGG + Intergenic
936640967 2:114312586-114312608 GCAAACAGGGGTATTGCGGGTGG - Intergenic
937066583 2:119022504-119022526 CCAAAGAGAGGTGTTAGGGGTGG + Intergenic
937271366 2:120654981-120655003 GCCAACCGGGGTGTTGGCAGGGG + Intergenic
937644458 2:124250639-124250661 GCATACAGGGGAGCTGGAGGAGG + Intronic
937800013 2:126072305-126072327 GCAAACAGGGGTTTTGGGGGTGG - Intergenic
937852882 2:126651160-126651182 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
938036477 2:128038945-128038967 CCAACCAGGGGTCTTGGGAGGGG - Intergenic
939068767 2:137515415-137515437 GCAAACAGGGGTGTTAGGGGAGG - Intronic
939213500 2:139209476-139209498 GAAAACAGGGGTGTTGGGGGTGG - Intergenic
939805929 2:146776032-146776054 GCAAACAGGGGTGTTGGGGTTGG - Intergenic
940171647 2:150835162-150835184 GCAAACAGGAGTGTTGGGGGTGG + Intergenic
940606236 2:155926800-155926822 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
941667680 2:168258734-168258756 GCAAACAGGGGTGTTGGGAGTGG - Intergenic
942772077 2:179533596-179533618 GAAAACAGGTGTGTGGGAGGGGG + Intronic
942987603 2:182161609-182161631 GCAAAGAGGGGTGGTAGGGGTGG - Intronic
943006235 2:182390955-182390977 GCAAACAGGGCTGTTGTGGTGGG - Intronic
943239524 2:185365038-185365060 GCAAACATGGGTGTTAGGGGTGG + Intergenic
943384337 2:187183299-187183321 GCAAACGGGGATGTTGGGGGTGG + Intergenic
943392225 2:187284243-187284265 GCAAACAGGGGTGTTGTGTGTGG + Intergenic
943509159 2:188802848-188802870 GCAAACAGAAGTGTTGGGGGTGG - Intergenic
943517913 2:188909685-188909707 GCAAACAGGGATGTTGGGGGTGG + Intergenic
943709150 2:191070843-191070865 GTAAAAAGGGGTGTGGGGGTGGG + Intronic
943808946 2:192160131-192160153 GCAAATATGTGTGTTTGGGGAGG + Intronic
944412552 2:199458185-199458207 GAAAAGAGGGGAGTGGGGGGCGG + Intronic
945146364 2:206742579-206742601 GCAAACAAGGGTGTTAGGGGTGG - Intronic
945544568 2:211135728-211135750 GCAAATAGGGGTGTTGTGGGTGG - Intergenic
945641855 2:212441409-212441431 GCAAACAGAGGTGATGGGGGTGG - Intronic
946321146 2:218955234-218955256 GCAAAAAGGGGGCTTGGTGGAGG + Intergenic
946617764 2:221528015-221528037 GGAAACGGCGGGGTTGGGGGTGG - Intronic
946727249 2:222672601-222672623 GTAAATAGGGGTGATGTGGGAGG + Intronic
946790609 2:223297308-223297330 GCAAATGGGGGTGTTGGGGGTGG - Intergenic
947550969 2:231046574-231046596 GCAAACCTGGGTGTTTGGTGGGG - Intronic
948340697 2:237248956-237248978 GCAAAGAGGGGTGGTGGGGGTGG + Intergenic
948948341 2:241233222-241233244 GCAAGAGGGGGTGTTGGGTGAGG + Intronic
949042321 2:241855118-241855140 CAAAATAGGGGGGTTGGGGGGGG - Intronic
1169757411 20:9058256-9058278 GAAAACGGGGGTGGTGGGGTTGG - Intergenic
1171296376 20:24020653-24020675 GAAAACAGGGGTGTTGGGGGTGG - Intergenic
1171767320 20:29297403-29297425 CCAACCACGGGGGTTGGGGGGGG + Intergenic
1172271642 20:33658653-33658675 GCAGAGAGGGGTGCTGGGGCTGG - Intronic
1173709462 20:45141688-45141710 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1174390475 20:50215843-50215865 GGAAACTGGGGGGCTGGGGGTGG + Intergenic
1174460414 20:50678407-50678429 GCAAACAGGCCTGTGGGGTGGGG - Intronic
1174476875 20:50801934-50801956 GACCACAGGGGTGTGGGGGGAGG + Intronic
1174540925 20:51288628-51288650 GCAGACAGGGTTGATGGGGGCGG + Intergenic
1175300619 20:57940395-57940417 GCAAACAGGAGTGAGGGGGTGGG + Intergenic
1175321987 20:58094703-58094725 GACATCAGAGGTGTTGGGGGAGG - Intergenic
1175550054 20:59811646-59811668 AAAGACAGGGGGGTTGGGGGTGG + Intronic
1176306498 21:5126269-5126291 GCAAACTGGGGTATGGGGGCCGG + Intronic
1176672073 21:9744518-9744540 CCAGACAGGGGAGGTGGGGGTGG + Intergenic
1176791989 21:13328600-13328622 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1176997834 21:15577782-15577804 GCAAACAGGGGTTTTGGGGGTGG - Intergenic
1177002948 21:15635984-15636006 GCAAACAGAGGTGTTGAGGGTGG + Intergenic
1177007472 21:15691528-15691550 GGAGATGGGGGTGTTGGGGGTGG - Intergenic
1177703499 21:24669823-24669845 ACACAGAGGTGTGTTGGGGGGGG + Intergenic
1177912870 21:27053786-27053808 GCAAACAAGGGTGTTGGGGGTGG - Intergenic
1177934016 21:27319360-27319382 GAAAACAGGGGTGTTGGGAGTGG + Intergenic
1177991386 21:28039606-28039628 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1178061063 21:28853591-28853613 GCAAACAGGAGTGTTGGGGGTGG + Intergenic
1178104685 21:29304648-29304670 GAAAAAAGGTGTGTAGGGGGAGG - Intronic
1178633936 21:34286114-34286136 GCAAAGAGGGATGGTGGGAGTGG - Intergenic
1178764148 21:35433376-35433398 GCAAACAGGGGTGTTAGGGGTGG + Intronic
1179144415 21:38754703-38754725 GCCTACAGTGGAGTTGGGGGTGG - Intergenic
1179850561 21:44135761-44135783 GCAAACTGGGGTATGGGGGCCGG - Intronic
1179916419 21:44480893-44480915 GCATGCAGGGGCGATGGGGGCGG + Intergenic
1181078983 22:20401400-20401422 GCCACCAGGGGTGCTGGGGCTGG - Intronic
1181127325 22:20709762-20709784 GCAGACAGGGTTCTTGGGTGAGG - Intronic
1182233093 22:28853925-28853947 GAGAAGAGGGGTGTCGGGGGAGG + Intergenic
1182284112 22:29234054-29234076 GGGAACAGAGGTGTTGGGGAGGG - Intronic
1182435354 22:30326515-30326537 GAAGGCAGGGGTGGTGGGGGTGG + Intronic
1182504373 22:30771394-30771416 GCAACCTGGGGTGCTGGGGAGGG + Intronic
1182965696 22:34519245-34519267 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1183208157 22:36433429-36433451 GCAAACAGGGGAGTGGGGGCTGG - Intergenic
1183489468 22:38108911-38108933 GCAATGAGGGGTGCTGGGTGTGG + Intronic
1184090541 22:42290803-42290825 GCACACAGGGGCCTTGGGGCAGG + Intronic
1184110530 22:42391338-42391360 ATGAACAGGGGTCTTGGGGGTGG + Intronic
1184603891 22:45560837-45560859 GCAAACAGGGGTGTTAGGGGTGG + Intronic
1185294624 22:50046978-50047000 GGGCACAGGGGTGCTGGGGGTGG + Intronic
1185295611 22:50052281-50052303 GCTAAGCAGGGTGTTGGGGGTGG - Intronic
949245547 3:1922472-1922494 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
949417979 3:3833627-3833649 GCAAACAGGGGTATTAGGGGTGG + Intronic
949445296 3:4128568-4128590 GCAAACAGGGCTGTTGTGGATGG - Intronic
949638464 3:6010081-6010103 GCAAATAGAGGTGTTGGGGGTGG - Intergenic
950467778 3:13165506-13165528 GCAAGCGGGGGGGTGGGGGGTGG + Intergenic
950501051 3:13364100-13364122 GCATGAAGGGGTGATGGGGGTGG - Intronic
950886326 3:16366095-16366117 GCAAAGAGGGTAGTTGGAGGCGG + Intronic
951122278 3:18943140-18943162 GCAAAAAGGGGTGTTGGGCGAGG - Intergenic
951384220 3:22025318-22025340 GCAAACAGAGGTTTTGGGGGTGG - Intronic
951978405 3:28540110-28540132 GCAAAGAGGGGTTCTGGGGGTGG - Intergenic
952090379 3:29878008-29878030 GTTGACAGGGGTGTTGGGGAGGG + Intronic
953095980 3:39777707-39777729 GCTAACAGGTGTGTGGGGGAAGG - Intergenic
953113844 3:39971368-39971390 TCAAAAAGGTGTATTGGGGGTGG + Intronic
953351131 3:42217038-42217060 GGAAATAGGGGGGTTGGGTGAGG - Intronic
953448013 3:42983870-42983892 AAAAACAGGGATGTCGGGGGTGG + Intronic
953897718 3:46814945-46814967 GCAAATGGGGGTGTTGGGGGTGG + Intergenic
954109017 3:48424073-48424095 ACCAGCAGGGGTGTGGGGGGTGG - Exonic
954296012 3:49674768-49674790 GCACACAGGTGTGTGGAGGGGGG + Intronic
954413530 3:50381637-50381659 GCAAGCAGGGGTGGGGGCGGGGG + Intronic
954463686 3:50642074-50642096 GGAAACTGGGGTGTCTGGGGTGG + Intronic
954511947 3:51133038-51133060 GTAAACAAGGGTGTTGGGGGTGG - Intronic
955035265 3:55261648-55261670 GCAAACAGGGGTGTTGGAAGCGG - Intergenic
955409837 3:58648410-58648432 GCAAAGAGGGGTTGAGGGGGTGG + Intronic
955924906 3:63995237-63995259 GGGAACGGGGGCGTTGGGGGTGG + Intronic
956509321 3:69977917-69977939 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
957247855 3:77735776-77735798 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
957634132 3:82759689-82759711 GAAAACAGGCGTGTAGAGGGTGG - Intergenic
957897803 3:86446306-86446328 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
958890749 3:99780072-99780094 GAAAACAGGGGTGGTGGTGGAGG - Intronic
959204104 3:103283227-103283249 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
959227089 3:103599738-103599760 GCAAACAGGGGTCTTGGGGATGG + Intergenic
959672155 3:108990811-108990833 GCTGACAGTGGTGATGGGGGTGG + Intronic
959791689 3:110369170-110369192 TTAATCAGGGATGTTGGGGGGGG - Intergenic
960349239 3:116573545-116573567 GCAAACAGGGGTCTTGGGGGTGG - Intronic
960495056 3:118363230-118363252 GCAAACAGGAATGTTGGGGATGG + Intergenic
961106082 3:124242775-124242797 GACAACAGGGGTGGTGAGGGTGG + Intronic
961134677 3:124499005-124499027 GCAAACAAGGGTGCTGTGGGAGG + Intronic
961871664 3:129992997-129993019 GCAATCAAGGGGGCTGGGGGAGG - Intergenic
962300806 3:134241086-134241108 CCAGACAGGGTTGGTGGGGGAGG + Intronic
962318977 3:134375567-134375589 GCTGGCAGGGGTGTAGGGGGAGG - Intergenic
962363936 3:134764855-134764877 GCTAACAGAGGTCTTGGGGATGG - Intronic
962715754 3:138124674-138124696 ACAAAAAGGGGTGGTGGGGGAGG + Exonic
963566545 3:146938244-146938266 GCAAACAAGGGTGTTGGCGGTGG - Intergenic
963661072 3:148129690-148129712 GAAAACAGGGGTGTTGGGGATGG - Intergenic
964128932 3:153266325-153266347 TCAAGGAGTGGTGTTGGGGGAGG + Intergenic
964358631 3:155871516-155871538 GCCTGCAGGGGCGTTGGGGGAGG - Intronic
964404203 3:156331327-156331349 AAAATCAGGGGTGGTGGGGGTGG + Intronic
964977516 3:162638234-162638256 GCAAACAGGGGTATTCGGGGTGG + Intergenic
965034861 3:163424938-163424960 GAAAACAGGGGTATTGGGGCTGG + Intergenic
965191142 3:165530990-165531012 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
965299241 3:166989254-166989276 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
965368157 3:167824932-167824954 GCTACTAGAGGTGTTGGGGGTGG + Intronic
965996113 3:174884880-174884902 GTAAACAGGAGTGTTGGGGGTGG + Intronic
966044643 3:175533364-175533386 GCAAACAGGGGTGTTGGGGGTGG + Intronic
966122341 3:176536621-176536643 TCTCACAGGGGTGTTTGGGGTGG + Intergenic
966425164 3:179773087-179773109 GCAAACTGCAGTGTTGGAGGTGG + Intronic
966445352 3:179996130-179996152 GCTAACAGGGGTGTTGGGGGTGG - Intronic
966896953 3:184452336-184452358 GCAAAAAGGGGTGGTGGGGGTGG + Intronic
966913676 3:184573239-184573261 GCAAGCAGGGGTGGGGGGCGGGG - Intronic
967505604 3:190249624-190249646 ACAAACAGATATGTTGGGGGTGG + Intergenic
967831443 3:193923531-193923553 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
968132447 3:196199408-196199430 GGACACAGGGGAGTTGGTGGTGG - Intronic
968188459 3:196649973-196649995 GCAGTCAGGGGAGGTGGGGGTGG + Intronic
968501663 4:953029-953051 GCGCACAGGGGTCTTGGGGTGGG - Intronic
968578346 4:1378189-1378211 GGAGACAGGGCTGATGGGGGTGG + Intronic
968844940 4:3035835-3035857 GCACACTGGGGTGACGGGGGAGG - Intronic
968906540 4:3455179-3455201 ACAAACAGGGGTGTTAGGGTTGG - Intergenic
969636793 4:8374038-8374060 CCACCCAGGGGAGTTGGGGGCGG + Intronic
970629211 4:17923017-17923039 GCAAACAGGGGTGTTGGGGTTGG - Intronic
971002815 4:22341405-22341427 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
971003301 4:22346686-22346708 GCAAAAAAGGGGGATGGGGGAGG - Intronic
972084916 4:35204590-35204612 GCAAACAGGGGTGTTGGGAATGG - Intergenic
972192589 4:36612832-36612854 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
972201601 4:36719593-36719615 GCAAACAGGAATGTTGAGAGTGG + Intergenic
972805649 4:42527591-42527613 GCAAACAGGGGTGTTGGGGGTGG - Intronic
973092682 4:46157882-46157904 GATGACAGGGGTGTTGGGGATGG - Intergenic
973118124 4:46486603-46486625 GCAAACAGGGATGTTGGGGGTGG - Intergenic
973121329 4:46523685-46523707 GCAGACAGAGGTGTTGGGGGTGG + Intergenic
974564486 4:63565874-63565896 GGCAAAAGGGGTGTTGAGGGTGG - Intergenic
974747216 4:66091370-66091392 GCAAACACGGGTTTTGGAGGTGG + Intergenic
976034510 4:80798195-80798217 GCAAACAGGGGTGTTGGGGGTGG + Intronic
977337678 4:95718836-95718858 GCAAAGAGGGGTGTTAGGTGTGG + Intergenic
977465675 4:97380960-97380982 GCAAACAGGGGTGTTGGAGGTGG - Intronic
977613502 4:99061531-99061553 GAAAACAGGTGTGCAGGGGGAGG - Exonic
977626925 4:99197767-99197789 GCAAACGGGGGTGTTGGGGGTGG + Intergenic
977702057 4:100032328-100032350 GCAAACAGGGGTATTGGGGGTGG + Intergenic
977847376 4:101781617-101781639 GCAAAGAAGGGTGGTGGGGGTGG + Intronic
977930704 4:102745951-102745973 GCAAACAGGGGTGTTGGGGGTGG + Intronic
978342155 4:107730043-107730065 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
978761633 4:112359651-112359673 GCCAGCAGGGGCCTTGGGGGAGG + Intronic
979084636 4:116391157-116391179 GCAAAGAGAGGTGATGGAGGTGG - Intergenic
979766710 4:124472354-124472376 GCAAACAGGGATATTGGGGGTGG - Intergenic
979810041 4:125025875-125025897 GCAAAGAGGGGACATGGGGGTGG + Intergenic
979898759 4:126191757-126191779 GAAAACAGAGGTGTTGGGTGTGG + Intergenic
980386559 4:132092926-132092948 GCAAACAGTGGTGTTGGGGGTGG + Intergenic
980406215 4:132356254-132356276 GCAAACAGGGGCGTTGGGGGTGG + Intergenic
980497845 4:133607822-133607844 GCAAACAGGAGAGTTGGGGGTGG + Intergenic
980957447 4:139443927-139443949 GCAAACAAGGGTATTGGGGGTGG - Intergenic
981251206 4:142603224-142603246 TCAGAGAGGGGTGTGGGGGGAGG + Intronic
981462473 4:145029350-145029372 GCAAACAAGGGTGTCGGGGGTGG - Intronic
981790910 4:148535747-148535769 GCACAGAGGGGAGTGGGGGGTGG - Intergenic
981834538 4:149040013-149040035 GCAAACAGAGGTGTTGCGGGTGG - Intergenic
982070018 4:151686654-151686676 GGAAACTGGGGGGTGGGGGGGGG - Intronic
982205076 4:152991589-152991611 GGAAAGAGGGATGTGGGGGGAGG + Intergenic
982526883 4:156489969-156489991 GCAAACAGGGTTGTTGTGGGTGG - Intergenic
982847465 4:160271858-160271880 GCAAACAGGAGTGTTGGTGGTGG - Intergenic
983581929 4:169317819-169317841 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
984050306 4:174857349-174857371 GCATGCAAGTGTGTTGGGGGTGG + Intronic
984061383 4:174992252-174992274 GCAAACAGGAGTGTTGGAAGTGG + Intergenic
985226160 4:187763934-187763956 GCAAAGAGGGGTGGTAGGGTGGG + Intergenic
985402662 4:189607330-189607352 CCAGACAGGGGAGGTGGGGGTGG - Intergenic
985815628 5:2125747-2125769 GTAGACTTGGGTGTTGGGGGTGG + Intergenic
986037356 5:3952888-3952910 GTAAACAGGGGTGTAGTGGGTGG + Intergenic
986086797 5:4460271-4460293 ACAAACAGGGATTTTGGGGGTGG - Intergenic
986938631 5:12921186-12921208 GCAAACAAGGGTGTTGAGGGTGG + Intergenic
986955856 5:13148583-13148605 GCCAACAGGGGTGTTGGGGGTGG + Intergenic
986959519 5:13196761-13196783 GCAAACAGAGGTGTTGGGAGTGG - Intergenic
987657434 5:20824080-20824102 GCAAACAGAGGTGTTGTGGGTGG + Intergenic
987885311 5:23805468-23805490 GCAAACAGGGGTTTTGGGGGTGG - Intergenic
988005380 5:25403536-25403558 GCAAAGAAGGGTGATGGGGGTGG - Intergenic
988107448 5:26770042-26770064 GCAAAAAGTGGTGTTAGGGATGG - Intergenic
988161125 5:27519319-27519341 GCAAATAGGGTTGTTTGGGGTGG + Intergenic
988169493 5:27635265-27635287 GCAAACATGGGTGTTGGAGGTGG + Intergenic
988188469 5:27898799-27898821 GCAAACAGGGGTATTGCTGGTGG - Intergenic
988233589 5:28509527-28509549 GTAAACAGCAGTGTTGGGGGTGG + Intergenic
988766112 5:34379866-34379888 GCAAACAGAGGTGTTGTGGGTGG - Intergenic
989213487 5:38880378-38880400 GGAAACAGGAGCGTTGGAGGAGG + Intronic
990591208 5:57266943-57266965 ACAATCTGGGGTGTTGGTGGGGG - Intergenic
991033221 5:62103465-62103487 GCAAATGGGGGTGTTGGTGGTGG - Intergenic
991587039 5:68212151-68212173 GCTAACTGATGTGTTGGGGGTGG - Intergenic
991945815 5:71897696-71897718 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
992330870 5:75716372-75716394 GGTAACAGGGGTGGGGGGGGGGG + Intronic
992508638 5:77412073-77412095 GCAAACAGATGGGATGGGGGAGG - Intronic
993901086 5:93584686-93584708 GGGAGCAGGGGTGTTGGGGGGGG + Exonic
994291703 5:98034425-98034447 GCAAACAGGGGTGCTGGGGGTGG + Intergenic
994836815 5:104865706-104865728 GCAAACAGAGGTGTTAGGAGTGG - Intergenic
994958146 5:106561890-106561912 GTAAACAGGGGTGGTGGGGGTGG - Intergenic
994984732 5:106918170-106918192 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
995021988 5:107377428-107377450 GCAAACGGGGGTGTTGGTGGAGG + Exonic
995269871 5:110207913-110207935 GCAAACAGGAATGTTGGGGGTGG + Intergenic
995279388 5:110316345-110316367 GTAAACAGGGGTGCTGGGGGTGG + Intronic
996165266 5:120214975-120214997 GCAGACAGGGGTATTGGGGGTGG + Intergenic
996373267 5:122775285-122775307 GCAAACACGGGGGATGGGGAGGG - Intronic
996532605 5:124542098-124542120 GGCAACAGGGGTGTTGGTTGTGG - Intergenic
996825241 5:127675371-127675393 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
997270734 5:132535607-132535629 GCAATAAGGGGTGTTGAGGGAGG - Intergenic
998004094 5:138646003-138646025 GCAAGCAGTGGTGATGGAGGAGG + Intronic
998757640 5:145398427-145398449 GAAAACAGGGGAGGTAGGGGAGG - Intergenic
999299967 5:150485365-150485387 GCAAAGGTGTGTGTTGGGGGAGG + Intergenic
1000147527 5:158467937-158467959 GGAAACAGTGGTGTTGGTGGTGG + Intergenic
1000223609 5:159237044-159237066 GCAAACAGGGGTGTTAGGGGTGG + Intergenic
1000302706 5:159970716-159970738 TCACACAGGGGTGTGGGGTGTGG - Intronic
1000462850 5:161544713-161544735 GCAAACAATGGAGTTGGGGCAGG + Intronic
1000730460 5:164828513-164828535 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1001135871 5:169102181-169102203 GGAAACATGTGTGTTGGGGTGGG + Intronic
1001935079 5:175697897-175697919 GCCATGAGGGGTGTTTGGGGAGG - Intergenic
1002104416 5:176872989-176873011 GGAAACTGTGGTGTTGGGGCAGG - Intronic
1002429379 5:179194250-179194272 TCGAACAGGGGTCTTGTGGGTGG - Intronic
1002813810 6:659981-660003 CCACTCAGGGCTGTTGGGGGGGG + Intronic
1002947688 6:1778890-1778912 GGCAGCAGGGGTGTTGGGGTTGG - Intronic
1003018813 6:2492253-2492275 GGGTACAGGGGAGTTGGGGGAGG - Intergenic
1003470226 6:6422520-6422542 GCAAAGAAGGGTGGTGGAGGTGG + Intergenic
1003696228 6:8408543-8408565 GCAAACAGGGGTATTGGGGGTGG + Intergenic
1003758279 6:9147599-9147621 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1004562570 6:16763346-16763368 GCCAAGCAGGGTGTTGGGGGCGG - Intergenic
1004622329 6:17342015-17342037 GCAAAAAAGGGTGGTGGGGTTGG - Intergenic
1005345303 6:24883482-24883504 GCAGAGAGAGGTTTTGGGGGTGG + Intronic
1006062025 6:31430711-31430733 GCAAACAGAGGTGTTAGGGGTGG - Intergenic
1006108234 6:31729269-31729291 GCAGACAAGGGCGTTGGGGGTGG + Exonic
1006294320 6:33163250-33163272 GAAGACAGGGGTCTCGGGGGTGG - Exonic
1006316788 6:33296188-33296210 GCAGGGAAGGGTGTTGGGGGGGG - Exonic
1006320319 6:33315976-33315998 GGAACCAGGGGTGTTGGCGCTGG + Exonic
1006700575 6:35969676-35969698 GCAAACAGGAGAGTGAGGGGTGG - Intronic
1007400402 6:41599609-41599631 GCAAACGGGGGTGGGGGTGGAGG - Exonic
1008121489 6:47622195-47622217 GGAAACAGGGCTGTTGGGGGAGG - Intronic
1008369312 6:50714920-50714942 GCAAACAGGCGAACTGGGGGTGG - Intronic
1009390422 6:63137503-63137525 GAAAACAGGAACGTTGGGGGTGG + Intergenic
1009630184 6:66188304-66188326 ACCAGCATGGGTGTTGGGGGTGG + Intergenic
1009806161 6:68604368-68604390 GCAAACAGGGCTGTTGGGGGTGG - Intergenic
1010323256 6:74538024-74538046 GCAGACAGGGATGTTGGGGGTGG - Intergenic
1010325634 6:74559043-74559065 GCAAATAGGGATGTTTGGGGCGG + Intergenic
1010552115 6:77236275-77236297 GCAGACAGGGGTGTTGAGGGTGG - Intergenic
1010581039 6:77596192-77596214 GCAAGCAGGGGTGTTGGGGATGG + Intergenic
1010818273 6:80385661-80385683 GCAAATAGAGGTGTAGAGGGTGG - Intergenic
1010938472 6:81888151-81888173 GCAAACAGGGGTATTGGGGGTGG + Intergenic
1011039678 6:83015705-83015727 GCAAACAGAGGTATTGGGGGTGG + Intronic
1011068773 6:83359248-83359270 GCAAACAGAGGTGTTGGGGGTGG - Intronic
1011101584 6:83728231-83728253 GCATACAAGGGTTTTGTGGGTGG - Intergenic
1011829838 6:91358288-91358310 AGAAATAGGGGTGTTGGGGGAGG + Intergenic
1011954741 6:93012903-93012925 GGTAACATGGGTGGTGGGGGAGG - Intergenic
1012730149 6:102871890-102871912 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1012820487 6:104080485-104080507 GCAAACAGAGGTATTGGGGGTGG - Intergenic
1013280112 6:108628355-108628377 TCATACAGGGCTTTTGGGGGAGG - Intronic
1014151227 6:118057923-118057945 GCAGGCAGGGATGTTTGGGGAGG + Intronic
1014416686 6:121192939-121192961 GTAAACAGGGGTGTTGGAGGTGG - Intronic
1014526489 6:122507624-122507646 GCCATCAGGCGTGTTGGGGGCGG + Intronic
1014534526 6:122599083-122599105 GCAAACAGAGGTGTTGGGGGTGG + Intronic
1014969933 6:127801764-127801786 GCACACAGGGGTGTTGGGGGTGG - Intronic
1015467248 6:133560671-133560693 GGAAACAGGAGTGTTTGTGGTGG + Intergenic
1016120220 6:140335088-140335110 GCAAACAGGGGTGTTAGTGGTGG + Intergenic
1016147618 6:140695161-140695183 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1016219886 6:141655163-141655185 ACAAACATAGGTGTTGGGGGTGG - Intergenic
1016420303 6:143875726-143875748 GCAAACAGAGGTGTTGGAGGTGG + Intronic
1016576569 6:145575042-145575064 GCAGACAGAGCTGTTGGGGGTGG + Intronic
1016845191 6:148562331-148562353 GCTAACAGGGGTTTTGGAGAGGG + Intergenic
1017044456 6:150334221-150334243 GCAAACAGGGGTGAGGGGGGCGG + Intergenic
1017228141 6:152043538-152043560 GCAAACAGGGGTATTGAGGGTGG + Intronic
1017634520 6:156430864-156430886 GCAAGCAGGGGTGGAGGGGTGGG + Intergenic
1017977433 6:159370491-159370513 GCAAACAGGGCCATTGTGGGTGG + Intergenic
1018569645 6:165195625-165195647 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1019409513 7:900480-900502 GCAGACAGGGGTGGTGGGGTGGG - Intronic
1019728709 7:2617684-2617706 GCAGGCTGGGGTGTTGGGGACGG - Intergenic
1020035296 7:4959987-4960009 GGAAGTCGGGGTGTTGGGGGGGG + Intergenic
1020106552 7:5424754-5424776 GCAAAGAGGGGCTTTGGGGAGGG - Intronic
1020135813 7:5587285-5587307 GCAAAGAGGGATGTGGGTGGAGG - Intergenic
1020396392 7:7723086-7723108 GCAAACAGGGATGTTGGCAGTGG - Intronic
1020710002 7:11595169-11595191 GCAAACAGGGGTGTTGGGGGTGG - Intronic
1020844616 7:13267364-13267386 TAAAAAAAGGGTGTTGGGGGTGG + Intergenic
1021149873 7:17136613-17136635 TGAAACAGGAGTTTTGGGGGTGG - Intergenic
1022078570 7:26997894-26997916 ATAAACAGGGGTGTTGGGGGTGG - Intergenic
1022339704 7:29456627-29456649 GAGAAGAGGGGTGTTGGTGGTGG - Intronic
1023813652 7:43931599-43931621 GCAAACCGGGGTGGGGGGGCGGG + Intronic
1024009396 7:45254809-45254831 GCAAAAAGGGGTGTTGGGGTTGG + Intergenic
1024040198 7:45547128-45547150 GCAAGCAGGGGTGTTGGGGGTGG + Intergenic
1024598035 7:50956214-50956236 GGCTACAGGGGTGCTGGGGGTGG + Intergenic
1024958581 7:54951528-54951550 GCAAACAGATGTATTGGGGGTGG + Intergenic
1026035158 7:66825234-66825256 GCAAACAGGGCAGCTGGAGGGGG + Intergenic
1026530052 7:71189428-71189450 GCCAACAGAGGTGGTGGGGGTGG + Intronic
1026984381 7:74545849-74545871 GCAAACAGGGCGGCTGGAGGGGG - Intronic
1027407131 7:77873508-77873530 GCAAACAGGGGTGTGAGAGGTGG + Intronic
1027979343 7:85197465-85197487 CAAAGCAGGGGTGGTGGGGGTGG - Intergenic
1028043548 7:86089019-86089041 GCAAACAGAGGTGTTGGTGGTGG - Intergenic
1028653747 7:93178723-93178745 ACAAACCGGGGAGTGGGGGGTGG + Intergenic
1029090197 7:98041830-98041852 GCTCACAGAGGTATTGGGGGTGG - Intergenic
1029551020 7:101237217-101237239 GCAGCCAGGAGTGCTGGGGGCGG - Intronic
1030368229 7:108670509-108670531 GCAAACAGGGGTATTGGGGGTGG - Intergenic
1031474758 7:122207788-122207810 GAAAACAGAGGTGTTGGGGGTGG + Intergenic
1031676251 7:124615894-124615916 GCAAACAAGGGCCTTGGGGGTGG - Intergenic
1031921171 7:127601788-127601810 GCACACAAGGATCTTGGGGGTGG - Exonic
1033075889 7:138250261-138250283 GAAAACTGGGGTGTTGGGGGTGG - Intergenic
1033122458 7:138678181-138678203 CAAAACAGGAGTGGTGGGGGAGG - Intronic
1034082261 7:148289790-148289812 GAAACCAAGGCTGTTGGGGGAGG + Intronic
1034498583 7:151436084-151436106 CCACACAGGGGTGGTGGGTGGGG - Intronic
1035351860 7:158252832-158252854 TCAATCGGGGGTGGTGGGGGTGG - Intronic
1038111570 8:24505560-24505582 GCAAACCTGGGGTTTGGGGGAGG + Intronic
1038119300 8:24594090-24594112 GAACACAGGGGTGGCGGGGGAGG + Intergenic
1038732760 8:30141946-30141968 GTTAACTGGGGTGTTGAGGGGGG - Intronic
1038839475 8:31168602-31168624 GGGAACAAGGGTGTTGGGGCTGG + Intronic
1039330299 8:36530420-36530442 GAAAACAAGAGTGTTGGGGGTGG - Intergenic
1039608701 8:38902207-38902229 GAAAAGAAGGGTGTGGGGGGGGG + Intronic
1040302437 8:46194993-46195015 GAAAACAGGGATGCTGGGTGGGG + Intergenic
1040444055 8:47475806-47475828 ACAAAAAGGGGTGCGGGGGGCGG - Intronic
1040836560 8:51737757-51737779 GCAGAAAGGAGTGGTGGGGGGGG - Intronic
1040916462 8:52570283-52570305 ACAAACAGGAGTGTTGGGGCTGG + Intergenic
1041714817 8:60923336-60923358 GCAAACTGGGCGGTGGGGGGGGG + Intergenic
1042001380 8:64126418-64126440 GCAAACAGGGCTGTTGGGGGTGG + Intergenic
1042067938 8:64899534-64899556 GAAAAAAGGGGTGCTGTGGGTGG - Intergenic
1043257692 8:78156937-78156959 GCAAACAGGGGTGTTGTGGGTGG - Intergenic
1043260280 8:78186600-78186622 ACAAACAGGGGTGTTTGGGGTGG + Intergenic
1044202075 8:89450037-89450059 GCAAACAGGGGTGTTGGGAGTGG - Intergenic
1044286292 8:90414897-90414919 GCAAACAGGGGTGGTGGGGGTGG + Intergenic
1044487479 8:92769598-92769620 GCAAACAAAGGTGTTGGGGGTGG + Intergenic
1044633751 8:94302258-94302280 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1044943681 8:97369947-97369969 GAAAAAAAGGGTGTTGGGGGAGG - Intergenic
1045221442 8:100204212-100204234 GCAAACAAGGTTGTTGGGGGTGG - Intronic
1045636776 8:104200184-104200206 GCAAAGAGGTATGTTGGGTGGGG + Intronic
1046197247 8:110881801-110881823 GAAAACAGAGGTGTTGGGGATGG - Intergenic
1046219370 8:111193224-111193246 ACAAACAGGTGTGTAGGGAGAGG + Intergenic
1046586098 8:116150075-116150097 GCAAACAGAGATGTTGGGGGTGG + Intergenic
1047024229 8:120809851-120809873 ACAAACAAGGTTGGTGGGGGAGG + Intronic
1048084204 8:131159597-131159619 GCAAACAGGGGTGTTGAGGGTGG + Intergenic
1048137092 8:131757042-131757064 GCAAACTGTGGTGGTGGAGGAGG - Intergenic
1048654672 8:136522672-136522694 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1048965186 8:139609767-139609789 GCAACAGAGGGTGTTGGGGGAGG + Intronic
1049646220 8:143736982-143737004 GCAACCAGGGGTGTTAGGCCAGG - Intergenic
1050447371 9:5739570-5739592 GCAAACAGAGGTGTTGGGAGTGG + Intronic
1051353283 9:16218274-16218296 GCAAAGGTGGCTGTTGGGGGAGG - Intronic
1051966095 9:22831786-22831808 GTAAAAAGGGGTATTGGGAGTGG - Intergenic
1052151752 9:25125970-25125992 GCAAACAGGGGTGTTGGGAGTGG + Intergenic
1052227291 9:26105925-26105947 GCAAACAGAGGTCTTAGGGGTGG - Intronic
1052718476 9:32146671-32146693 GCAAACAGGGGTGTTGGGGTGGG - Intergenic
1053018940 9:34681305-34681327 CCAATCAGGTGTGTTGGTGGTGG + Intergenic
1055205321 9:73722805-73722827 GCAAAGAGGGGTGTTGGGGATGG - Intergenic
1055336403 9:75237076-75237098 GCCTTCAGGGGTGTTGGGGCAGG + Intergenic
1056314561 9:85375397-85375419 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1056377931 9:86032518-86032540 ACAAACAAGTGTGTTGGAGGAGG + Intronic
1057316259 9:93970684-93970706 GCAAACAGGGATGTTGGGGGTGG - Intergenic
1058579256 9:106437074-106437096 GTCATCAGGGGTGTTTGGGGAGG + Intergenic
1058779210 9:108316669-108316691 GCAGACACAGGGGTTGGGGGGGG - Intergenic
1059285175 9:113166118-113166140 CCAAAAAGGGGCGTTGGGGGCGG + Exonic
1059345746 9:113626807-113626829 GAGAACAGGGGTGCTGGGGTTGG - Intergenic
1059768835 9:117408978-117409000 ATAAACAAGGGTCTTGGGGGAGG - Intronic
1060232563 9:121836516-121836538 TTAAACTGGGGTGTCGGGGGAGG - Intronic
1060805696 9:126574800-126574822 GCAAAGAGGGGTAGTGGGGATGG + Intergenic
1060997880 9:127885386-127885408 GCACACTGGGGTGATGGGTGGGG - Exonic
1061293821 9:129666572-129666594 GCAAACTGGAGGGTGGGGGGGGG - Intronic
1061394180 9:130334224-130334246 GGATGCAGGGGAGTTGGGGGTGG + Intronic
1061595248 9:131624656-131624678 GATAACAGGGGTGGAGGGGGAGG + Intronic
1061936607 9:133861196-133861218 GCAGGAAGGGGTGTGGGGGGCGG - Intronic
1062217470 9:135397061-135397083 GCACACGGGGGTCCTGGGGGTGG - Intergenic
1062390785 9:136333066-136333088 GCAAACAGGAATGATGGGGCCGG + Intronic
1062474300 9:136719794-136719816 GCACACAGTGGTGCTGGGGAAGG - Intronic
1185513896 X:683958-683980 TCAAACAGGGGTGTGTGGGATGG - Intergenic
1186279314 X:7975707-7975729 GCAAACAGGGGTGTTAGGGGTGG - Intergenic
1186470113 X:9814531-9814553 GCAAACAGGGGTGTCGGGGGTGG + Intronic
1187368759 X:18686452-18686474 GCAAAAAGGAGTGTTTGGGGTGG - Intronic
1191096632 X:56679965-56679987 GCAAACAGGGGTATTGGGGTGGG + Intergenic
1191226388 X:58048846-58048868 GCAAACAGGGGTGTTGGAGGTGG - Intergenic
1191630415 X:63315660-63315682 TCAAACAGTGGTGTTGGAGGTGG + Intergenic
1191719561 X:64218111-64218133 GCAAACAGCGGTGTTGCGGGTGG + Intergenic
1191742846 X:64453752-64453774 GCAAAGAGGGGTGTTGGAGGTGG + Intergenic
1191759045 X:64627459-64627481 GCAAACAGAGGTTTTGGGGGTGG - Intergenic
1191769809 X:64742549-64742571 GCAAATAGAGGTGTTGGTGGTGG + Intergenic
1191941551 X:66486309-66486331 GCAAACAGGGATGTTGTAGGTGG + Intergenic
1191945940 X:66535457-66535479 GCAAATAGAGGTGTTGGCGGTGG - Intergenic
1192298037 X:69870441-69870463 GCAAACAGAGATGTTGGGGGTGG + Intronic
1192661880 X:73050210-73050232 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
1192995908 X:76513133-76513155 GCAAACAGGAGGGTTGGGAGTGG - Intergenic
1193053116 X:77122727-77122749 GCAAACAGGGATGATGGGGGTGG - Intergenic
1193155959 X:78174472-78174494 GCAAACAGGGATGTTGGGGGTGG + Intergenic
1193297477 X:79850246-79850268 GCAAACATGGGTGTAGGGGGTGG - Intergenic
1193531596 X:82660861-82660883 GCAAAGAGGGATGGTGGGGGTGG + Intergenic
1193832625 X:86307667-86307689 GCAAACAGAGGTGTTGGGGGTGG - Intronic
1193879134 X:86900191-86900213 AGCAACGGGGGTGTTGGGGGTGG + Intergenic
1193904282 X:87224105-87224127 GCAAACAGAGGTTTTAGGGGTGG - Intergenic
1194032318 X:88832308-88832330 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1194179903 X:90698409-90698431 GCACACAAGGGTGTTCGGGGTGG + Intergenic
1194209962 X:91059907-91059929 GTAAACAGAGGTGTTGGGATTGG - Intergenic
1194342999 X:92728657-92728679 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1194604715 X:95964437-95964459 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1194833618 X:98656350-98656372 GCAAACAGGGGTGTTGGGGGCGG - Intergenic
1195349666 X:103984599-103984621 GCAATCACAGGTGGTGGGGGTGG + Intergenic
1195357777 X:104054240-104054262 GCAATCACAGGTGGTGGGGGTGG - Intergenic
1195749173 X:108147128-108147150 GCAAACAGGGGTGTTGGGGGTGG + Intronic
1195809982 X:108818280-108818302 GCAAACAGGGTTGTTGGGGGTGG + Intergenic
1195875049 X:109531760-109531782 GGTCACAGGGGTGTTGGGGCAGG - Intergenic
1196180885 X:112688318-112688340 GGAAACAGGGTGGTTGGAGGAGG - Intergenic
1196275503 X:113761665-113761687 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1196368729 X:114951920-114951942 GCACTCAGAGGTGATGGGGGAGG - Intergenic
1196463871 X:115953404-115953426 GAGAACAGGTGTGTTCGGGGAGG - Intergenic
1196528682 X:116758150-116758172 GCAAAGAGGGGTGATGAAGGTGG - Intergenic
1196886582 X:120251400-120251422 GCAGGGTGGGGTGTTGGGGGGGG - Intronic
1197001983 X:121450599-121450621 GCAAACAGAGGTGTTGGGGGTGG - Intergenic
1197044144 X:121975994-121976016 GCAAACGGGGGTGTTGGGGTTGG - Intergenic
1197074370 X:122337351-122337373 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1197097153 X:122610389-122610411 GCAAACTGGGCTGTTGGGGGTGG - Intergenic
1197245426 X:124161768-124161790 GCAAATAGGGGTGTTGGGGGTGG + Intronic
1197328674 X:125126342-125126364 GCAAGCAGTGGTCTTGAGGGAGG + Intergenic
1197372335 X:125640301-125640323 GCAAACACGGGTGATGGAGATGG + Intergenic
1197404774 X:126036736-126036758 GCAAACAGAGATGTTGGGGGTGG - Intergenic
1197409535 X:126098284-126098306 TCAAACAGGGGTTTTGTGGGTGG + Intergenic
1197426053 X:126298064-126298086 TCAAACAGGGGTATTGAGGGTGG + Intergenic
1197477679 X:126943779-126943801 GCAAACAGGGGTGTTGGGGGTGG + Intergenic
1197537313 X:127706815-127706837 GCAAAGAGGGGTGGTGGGGGTGG - Intergenic
1197554585 X:127938003-127938025 GCAAACAGGGATGTTGGGGGTGG + Intergenic
1197591540 X:128416894-128416916 GCAAACAGAGGTGTTCGGGGTGG - Intergenic
1197602741 X:128548883-128548905 GCAAACCTGGGTGCTGGGGGAGG - Intergenic
1197762034 X:130034775-130034797 GCAATCTGGGGTGTAGAGGGAGG - Intronic
1197956233 X:131951422-131951444 GAAAACAGGAGTGTCGGGGGTGG - Intergenic
1198004579 X:132479873-132479895 GGAGTCAGGGGAGTTGGGGGTGG + Intronic
1198169723 X:134093813-134093835 GCAAAGAAGGGTGGTGGGGGTGG - Intergenic
1198700925 X:139397447-139397469 GTAAACAGGGGTGTTGAGGGTGG - Intergenic
1198783357 X:140260247-140260269 GCAAACAGCGGTGTTGGGGGTGG + Intergenic
1198808320 X:140510130-140510152 GCAAAGACGGGTGTAGGAGGGGG - Intergenic
1199275745 X:145940023-145940045 AAAAACAGGGGGGTTGGGGGTGG - Intergenic
1200340613 X:155391538-155391560 GCAAACAGGGGTATTAGGGTTGG + Intergenic
1200520979 Y:4209593-4209615 GCAAACAGGGGTGTTTGGGGTGG - Intergenic
1200526559 Y:4280578-4280600 GCACACAAGGGTGTTCGGGGTGG + Intergenic
1200651360 Y:5845323-5845345 GCAAACAGGGGTGTTGGGGGTGG - Intergenic
1200973368 Y:9180004-9180026 ACAAACAGAGGTGTTGGGGATGG + Intergenic
1201057192 Y:10006488-10006510 TCACTCAGGGGTGGTGGGGGAGG + Intergenic
1201400286 Y:13597445-13597467 GCAAAGAGGGTTGTTGAAGGTGG + Intergenic
1201431532 Y:13907591-13907613 CCAAAAAGGGGTGGTGGGGAGGG + Intergenic
1201529933 Y:14980463-14980485 GCAAACAGAGGTGTTGGGGGTGG + Intergenic
1201798158 Y:17924259-17924281 CCAAACAGAGATGTTGGGGGTGG - Intergenic
1201803395 Y:17981698-17981720 CCAAACAGAGATGTTGGGGGTGG + Intergenic
1202075906 Y:21037861-21037883 GCAGACAGGAGTGGGGGGGGGGG - Intergenic
1202359483 Y:24092950-24092972 CCAAACAGAGATGTTGGGGGTGG - Intergenic
1202511295 Y:25577164-25577186 CCAAACAGAGATGTTGGGGGTGG + Intergenic