ID: 1177991997

View in Genome Browser
Species Human (GRCh38)
Location 21:28047953-28047975
Sequence CATTGTGAGCTCAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177991997_1177992002 8 Left 1177991997 21:28047953-28047975 CCTTCTTCCTTGAGCTCACAATG No data
Right 1177992002 21:28047984-28048006 TGTTATAGGCTGATGGCTACAGG No data
1177991997_1177992000 1 Left 1177991997 21:28047953-28047975 CCTTCTTCCTTGAGCTCACAATG No data
Right 1177992000 21:28047977-28047999 GATCTCCTGTTATAGGCTGATGG No data
1177991997_1177991999 -6 Left 1177991997 21:28047953-28047975 CCTTCTTCCTTGAGCTCACAATG No data
Right 1177991999 21:28047970-28047992 ACAATGAGATCTCCTGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177991997 Original CRISPR CATTGTGAGCTCAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr