ID: 1177992517

View in Genome Browser
Species Human (GRCh38)
Location 21:28055470-28055492
Sequence ATGTTGTAGCTTACTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177992517_1177992523 22 Left 1177992517 21:28055470-28055492 CCTTGTTCAGTAAGCTACAACAT No data
Right 1177992523 21:28055515-28055537 GGCTTAAATCGAGGTCTCAAAGG No data
1177992517_1177992521 13 Left 1177992517 21:28055470-28055492 CCTTGTTCAGTAAGCTACAACAT No data
Right 1177992521 21:28055506-28055528 GAAATCCTGGGCTTAAATCGAGG No data
1177992517_1177992519 1 Left 1177992517 21:28055470-28055492 CCTTGTTCAGTAAGCTACAACAT No data
Right 1177992519 21:28055494-28055516 CTCGTATCTCCTGAAATCCTGGG No data
1177992517_1177992518 0 Left 1177992517 21:28055470-28055492 CCTTGTTCAGTAAGCTACAACAT No data
Right 1177992518 21:28055493-28055515 ACTCGTATCTCCTGAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177992517 Original CRISPR ATGTTGTAGCTTACTGAACA AGG (reversed) Intergenic
No off target data available for this crispr