ID: 1177992730

View in Genome Browser
Species Human (GRCh38)
Location 21:28058182-28058204
Sequence CTAAATGCTGACAATGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177992727_1177992730 4 Left 1177992727 21:28058155-28058177 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177992730 Original CRISPR CTAAATGCTGACAATGATAT GGG Intergenic
No off target data available for this crispr