ID: 1177996013

View in Genome Browser
Species Human (GRCh38)
Location 21:28098720-28098742
Sequence CTGAAAATACAAAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177996013_1177996018 7 Left 1177996013 21:28098720-28098742 CCCAGCTACTTTTGTATTTTCAG No data
Right 1177996018 21:28098750-28098772 TGGGTTTCTCCATGTTGGTCAGG 0: 349
1: 18140
2: 39255
3: 147523
4: 194301
1177996013_1177996019 11 Left 1177996013 21:28098720-28098742 CCCAGCTACTTTTGTATTTTCAG No data
Right 1177996019 21:28098754-28098776 TTTCTCCATGTTGGTCAGGCTGG 0: 18586
1: 36319
2: 134688
3: 174060
4: 144372
1177996013_1177996017 2 Left 1177996013 21:28098720-28098742 CCCAGCTACTTTTGTATTTTCAG No data
Right 1177996017 21:28098745-28098767 GAGACTGGGTTTCTCCATGTTGG 0: 244
1: 14155
2: 94945
3: 152603
4: 122170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177996013 Original CRISPR CTGAAAATACAAAAGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr