ID: 1178002807

View in Genome Browser
Species Human (GRCh38)
Location 21:28182570-28182592
Sequence CCTCATGGAGAGTCTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178002799_1178002807 16 Left 1178002799 21:28182531-28182553 CCTAGATGTCCAGGCAGAAGTCT No data
Right 1178002807 21:28182570-28182592 CCTCATGGAGAGTCTCTGCTAGG No data
1178002801_1178002807 7 Left 1178002801 21:28182540-28182562 CCAGGCAGAAGTCTGCTGCAGGG 0: 274
1: 1242
2: 1888
3: 1625
4: 1294
Right 1178002807 21:28182570-28182592 CCTCATGGAGAGTCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178002807 Original CRISPR CCTCATGGAGAGTCTCTGCT AGG Intergenic
No off target data available for this crispr