ID: 1178003844

View in Genome Browser
Species Human (GRCh38)
Location 21:28194306-28194328
Sequence GGGTGCTTATCTATTTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178003844_1178003846 -6 Left 1178003844 21:28194306-28194328 CCATCTTAAATAGATAAGCACCC No data
Right 1178003846 21:28194323-28194345 GCACCCAACCCTGGAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178003844 Original CRISPR GGGTGCTTATCTATTTAAGA TGG (reversed) Intergenic
No off target data available for this crispr