ID: 1178005494

View in Genome Browser
Species Human (GRCh38)
Location 21:28215389-28215411
Sequence CAGAACCAGGAGAACTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178005487_1178005494 24 Left 1178005487 21:28215342-28215364 CCAACAGACCAAAATATTTCATC No data
Right 1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG No data
1178005490_1178005494 -10 Left 1178005490 21:28215376-28215398 CCAAGTGGCTGCCCAGAACCAGG No data
Right 1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG No data
1178005488_1178005494 16 Left 1178005488 21:28215350-28215372 CCAAAATATTTCATCATCAAGAA No data
Right 1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178005494 Original CRISPR CAGAACCAGGAGAACTGATA TGG Intergenic
No off target data available for this crispr