ID: 1178012129

View in Genome Browser
Species Human (GRCh38)
Location 21:28300859-28300881
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012129_1178012137 26 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012137 21:28300908-28300930 GGGAATAACAGCTGGGCAGTGGG No data
1178012129_1178012131 5 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012131 21:28300887-28300909 AACCACTAAAATACAGGACATGG No data
1178012129_1178012134 18 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012134 21:28300900-28300922 CAGGACATGGGAATAACAGCTGG No data
1178012129_1178012135 19 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012135 21:28300901-28300923 AGGACATGGGAATAACAGCTGGG No data
1178012129_1178012132 6 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012132 21:28300888-28300910 ACCACTAAAATACAGGACATGGG No data
1178012129_1178012136 25 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012136 21:28300907-28300929 TGGGAATAACAGCTGGGCAGTGG No data
1178012129_1178012130 -1 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012130 21:28300881-28300903 TTAGTAAACCACTAAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012129 Original CRISPR AATAGAAACACTTCACTTTA AGG (reversed) Intergenic