ID: 1178012130

View in Genome Browser
Species Human (GRCh38)
Location 21:28300881-28300903
Sequence TTAGTAAACCACTAAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012129_1178012130 -1 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012130 21:28300881-28300903 TTAGTAAACCACTAAAATACAGG No data
1178012128_1178012130 18 Left 1178012128 21:28300840-28300862 CCTAGTAGAGAAACTGATACCTT No data
Right 1178012130 21:28300881-28300903 TTAGTAAACCACTAAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012130 Original CRISPR TTAGTAAACCACTAAAATAC AGG Intergenic
No off target data available for this crispr