ID: 1178012133

View in Genome Browser
Species Human (GRCh38)
Location 21:28300889-28300911
Sequence TCCCATGTCCTGTATTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012133_1178012137 -4 Left 1178012133 21:28300889-28300911 CCACTAAAATACAGGACATGGGA No data
Right 1178012137 21:28300908-28300930 GGGAATAACAGCTGGGCAGTGGG No data
1178012133_1178012139 7 Left 1178012133 21:28300889-28300911 CCACTAAAATACAGGACATGGGA No data
Right 1178012139 21:28300919-28300941 CTGGGCAGTGGGCAGTGTGGTGG No data
1178012133_1178012138 4 Left 1178012133 21:28300889-28300911 CCACTAAAATACAGGACATGGGA No data
Right 1178012138 21:28300916-28300938 CAGCTGGGCAGTGGGCAGTGTGG No data
1178012133_1178012136 -5 Left 1178012133 21:28300889-28300911 CCACTAAAATACAGGACATGGGA No data
Right 1178012136 21:28300907-28300929 TGGGAATAACAGCTGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012133 Original CRISPR TCCCATGTCCTGTATTTTAG TGG (reversed) Intergenic
No off target data available for this crispr