ID: 1178012135

View in Genome Browser
Species Human (GRCh38)
Location 21:28300901-28300923
Sequence AGGACATGGGAATAACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012129_1178012135 19 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012135 21:28300901-28300923 AGGACATGGGAATAACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012135 Original CRISPR AGGACATGGGAATAACAGCT GGG Intergenic
No off target data available for this crispr