ID: 1178012136

View in Genome Browser
Species Human (GRCh38)
Location 21:28300907-28300929
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012133_1178012136 -5 Left 1178012133 21:28300889-28300911 CCACTAAAATACAGGACATGGGA No data
Right 1178012136 21:28300907-28300929 TGGGAATAACAGCTGGGCAGTGG No data
1178012129_1178012136 25 Left 1178012129 21:28300859-28300881 CCTTAAAGTGAAGTGTTTCTATT No data
Right 1178012136 21:28300907-28300929 TGGGAATAACAGCTGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012136 Original CRISPR TGGGAATAACAGCTGGGCAG TGG Intergenic