ID: 1178012657

View in Genome Browser
Species Human (GRCh38)
Location 21:28305146-28305168
Sequence AGTTATCAGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012657_1178012661 15 Left 1178012657 21:28305146-28305168 CCTGCCATCTTCTGCTGATAACT No data
Right 1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG No data
1178012657_1178012663 25 Left 1178012657 21:28305146-28305168 CCTGCCATCTTCTGCTGATAACT No data
Right 1178012663 21:28305194-28305216 GGCCTGCTACTGGACTTTGGTGG No data
1178012657_1178012659 4 Left 1178012657 21:28305146-28305168 CCTGCCATCTTCTGCTGATAACT No data
Right 1178012659 21:28305173-28305195 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1178012657_1178012662 22 Left 1178012657 21:28305146-28305168 CCTGCCATCTTCTGCTGATAACT No data
Right 1178012662 21:28305191-28305213 CTTGGCCTGCTACTGGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012657 Original CRISPR AGTTATCAGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr