ID: 1178012661

View in Genome Browser
Species Human (GRCh38)
Location 21:28305184-28305206
Sequence GACAGCTCTTGGCCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012656_1178012661 16 Left 1178012656 21:28305145-28305167 CCCTGCCATCTTCTGCTGATAAC No data
Right 1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG No data
1178012657_1178012661 15 Left 1178012657 21:28305146-28305168 CCTGCCATCTTCTGCTGATAACT No data
Right 1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG No data
1178012658_1178012661 11 Left 1178012658 21:28305150-28305172 CCATCTTCTGCTGATAACTACTC No data
Right 1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012661 Original CRISPR GACAGCTCTTGGCCTGCTAC TGG Intergenic
No off target data available for this crispr