ID: 1178012663

View in Genome Browser
Species Human (GRCh38)
Location 21:28305194-28305216
Sequence GGCCTGCTACTGGACTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012656_1178012663 26 Left 1178012656 21:28305145-28305167 CCCTGCCATCTTCTGCTGATAAC No data
Right 1178012663 21:28305194-28305216 GGCCTGCTACTGGACTTTGGTGG No data
1178012657_1178012663 25 Left 1178012657 21:28305146-28305168 CCTGCCATCTTCTGCTGATAACT No data
Right 1178012663 21:28305194-28305216 GGCCTGCTACTGGACTTTGGTGG No data
1178012658_1178012663 21 Left 1178012658 21:28305150-28305172 CCATCTTCTGCTGATAACTACTC No data
Right 1178012663 21:28305194-28305216 GGCCTGCTACTGGACTTTGGTGG No data
1178012660_1178012663 -3 Left 1178012660 21:28305174-28305196 CCTTTTGAGAGACAGCTCTTGGC 0: 173
1: 182
2: 165
3: 95
4: 236
Right 1178012663 21:28305194-28305216 GGCCTGCTACTGGACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012663 Original CRISPR GGCCTGCTACTGGACTTTGG TGG Intergenic
No off target data available for this crispr