ID: 1178012736

View in Genome Browser
Species Human (GRCh38)
Location 21:28305702-28305724
Sequence TCAGTATGCAGTCGCACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178012736_1178012742 23 Left 1178012736 21:28305702-28305724 CCAGATGTGCGACTGCATACTGA No data
Right 1178012742 21:28305748-28305770 TGACTGGATGATGAGGGACTTGG No data
1178012736_1178012741 17 Left 1178012736 21:28305702-28305724 CCAGATGTGCGACTGCATACTGA No data
Right 1178012741 21:28305742-28305764 ATCGTTTGACTGGATGATGAGGG No data
1178012736_1178012740 16 Left 1178012736 21:28305702-28305724 CCAGATGTGCGACTGCATACTGA No data
Right 1178012740 21:28305741-28305763 AATCGTTTGACTGGATGATGAGG No data
1178012736_1178012737 -9 Left 1178012736 21:28305702-28305724 CCAGATGTGCGACTGCATACTGA No data
Right 1178012737 21:28305716-28305738 GCATACTGATATATGAGCTGCGG No data
1178012736_1178012738 7 Left 1178012736 21:28305702-28305724 CCAGATGTGCGACTGCATACTGA No data
Right 1178012738 21:28305732-28305754 GCTGCGGCCAATCGTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178012736 Original CRISPR TCAGTATGCAGTCGCACATC TGG (reversed) Intergenic
No off target data available for this crispr