ID: 1178014400

View in Genome Browser
Species Human (GRCh38)
Location 21:28326997-28327019
Sequence TCATGTCCTTGCCATGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178014400_1178014401 19 Left 1178014400 21:28326997-28327019 CCTGGCTCATGGCAAGGACATGA No data
Right 1178014401 21:28327039-28327061 TATCTTAAAAGTATTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178014400 Original CRISPR TCATGTCCTTGCCATGAGCC AGG (reversed) Intergenic
No off target data available for this crispr