ID: 1178015611

View in Genome Browser
Species Human (GRCh38)
Location 21:28343044-28343066
Sequence CTTTATAAATTACCAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178015611_1178015617 22 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015617 21:28343089-28343111 ATTTCTGCATGGCTGGCAGCGGG No data
1178015611_1178015615 15 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015615 21:28343082-28343104 GACTCACATTTCTGCATGGCTGG 0: 17
1: 1085
2: 2874
3: 6246
4: 8322
1178015611_1178015619 26 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015619 21:28343093-28343115 CTGCATGGCTGGCAGCGGGGTGG No data
1178015611_1178015621 28 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015621 21:28343095-28343117 GCATGGCTGGCAGCGGGGTGGGG No data
1178015611_1178015618 23 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015618 21:28343090-28343112 TTTCTGCATGGCTGGCAGCGGGG No data
1178015611_1178015616 21 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015616 21:28343088-28343110 CATTTCTGCATGGCTGGCAGCGG No data
1178015611_1178015614 11 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015614 21:28343078-28343100 AATTGACTCACATTTCTGCATGG 0: 25
1: 1531
2: 3171
3: 5051
4: 6198
1178015611_1178015622 29 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015622 21:28343096-28343118 CATGGCTGGCAGCGGGGTGGGGG No data
1178015611_1178015620 27 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015620 21:28343094-28343116 TGCATGGCTGGCAGCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178015611 Original CRISPR CTTTATAAATTACCAGCCTT GGG (reversed) Intergenic
No off target data available for this crispr