ID: 1178015619

View in Genome Browser
Species Human (GRCh38)
Location 21:28343093-28343115
Sequence CTGCATGGCTGGCAGCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178015612_1178015619 25 Left 1178015612 21:28343045-28343067 CCAAGGCTGGTAATTTATAAAGA No data
Right 1178015619 21:28343093-28343115 CTGCATGGCTGGCAGCGGGGTGG No data
1178015611_1178015619 26 Left 1178015611 21:28343044-28343066 CCCAAGGCTGGTAATTTATAAAG No data
Right 1178015619 21:28343093-28343115 CTGCATGGCTGGCAGCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178015619 Original CRISPR CTGCATGGCTGGCAGCGGGG TGG Intergenic
No off target data available for this crispr