ID: 1178022936

View in Genome Browser
Species Human (GRCh38)
Location 21:28430707-28430729
Sequence GCCACACTGAATGCCAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178022936_1178022946 27 Left 1178022936 21:28430707-28430729 CCCACCCTGGCATTCAGTGTGGC No data
Right 1178022946 21:28430757-28430779 CCATCCGGTAAAGAAAAACCTGG No data
1178022936_1178022941 12 Left 1178022936 21:28430707-28430729 CCCACCCTGGCATTCAGTGTGGC No data
Right 1178022941 21:28430742-28430764 TACCTAAATGTCCTCCCATCCGG No data
1178022936_1178022947 28 Left 1178022936 21:28430707-28430729 CCCACCCTGGCATTCAGTGTGGC No data
Right 1178022947 21:28430758-28430780 CATCCGGTAAAGAAAAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178022936 Original CRISPR GCCACACTGAATGCCAGGGT GGG (reversed) Intergenic
No off target data available for this crispr