ID: 1178024881

View in Genome Browser
Species Human (GRCh38)
Location 21:28454959-28454981
Sequence CTGTTTCTGCAAAAGCCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178024878_1178024881 13 Left 1178024878 21:28454923-28454945 CCAAACATCTGGATTCTTCCACA No data
Right 1178024881 21:28454959-28454981 CTGTTTCTGCAAAAGCCAATAGG No data
1178024880_1178024881 -5 Left 1178024880 21:28454941-28454963 CCACACATGGCGCATTAGCTGTT No data
Right 1178024881 21:28454959-28454981 CTGTTTCTGCAAAAGCCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178024881 Original CRISPR CTGTTTCTGCAAAAGCCAAT AGG Intergenic
No off target data available for this crispr