ID: 1178024946

View in Genome Browser
Species Human (GRCh38)
Location 21:28455857-28455879
Sequence GGTTGCCCAAACTGTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178024942_1178024946 27 Left 1178024942 21:28455807-28455829 CCAAACTAAGTAAATACGAAGCA No data
Right 1178024946 21:28455857-28455879 GGTTGCCCAAACTGTCCCACAGG No data
1178024945_1178024946 -9 Left 1178024945 21:28455843-28455865 CCGTTACTAATTTAGGTTGCCCA No data
Right 1178024946 21:28455857-28455879 GGTTGCCCAAACTGTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178024946 Original CRISPR GGTTGCCCAAACTGTCCCAC AGG Intergenic
No off target data available for this crispr