ID: 1178026522

View in Genome Browser
Species Human (GRCh38)
Location 21:28474601-28474623
Sequence CTGAGATACCAAAAGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178026522_1178026528 25 Left 1178026522 21:28474601-28474623 CCCCATTCCTTTTGGTATCTCAG No data
Right 1178026528 21:28474649-28474671 TTCTACAAATTAATCGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178026522 Original CRISPR CTGAGATACCAAAAGGAATG GGG (reversed) Intergenic
No off target data available for this crispr