ID: 1178027347

View in Genome Browser
Species Human (GRCh38)
Location 21:28483306-28483328
Sequence CATCAGAAGGAGACTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178027344_1178027347 -1 Left 1178027344 21:28483284-28483306 CCTGGAATGGCTAAGAAACAGGC No data
Right 1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178027347 Original CRISPR CATCAGAAGGAGACTCAGGA TGG Intergenic
No off target data available for this crispr