ID: 1178028334

View in Genome Browser
Species Human (GRCh38)
Location 21:28493931-28493953
Sequence TCTGATATGTGAACTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178028331_1178028334 18 Left 1178028331 21:28493890-28493912 CCTTTGTTCTTTCTGGGGAAAAT No data
Right 1178028334 21:28493931-28493953 TCTGATATGTGAACTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178028334 Original CRISPR TCTGATATGTGAACTGTGGA TGG Intergenic
No off target data available for this crispr