ID: 1178028755

View in Genome Browser
Species Human (GRCh38)
Location 21:28499802-28499824
Sequence GAAAGCCAAACGTCCTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178028755_1178028756 -7 Left 1178028755 21:28499802-28499824 CCTTTTCAGGACGTTTGGCTTTC No data
Right 1178028756 21:28499818-28499840 GGCTTTCAGATTATTCAAACAGG No data
1178028755_1178028758 25 Left 1178028755 21:28499802-28499824 CCTTTTCAGGACGTTTGGCTTTC No data
Right 1178028758 21:28499850-28499872 ATGAGAAGCAGTCATACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178028755 Original CRISPR GAAAGCCAAACGTCCTGAAA AGG (reversed) Intergenic
No off target data available for this crispr