ID: 1178028758

View in Genome Browser
Species Human (GRCh38)
Location 21:28499850-28499872
Sequence ATGAGAAGCAGTCATACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178028755_1178028758 25 Left 1178028755 21:28499802-28499824 CCTTTTCAGGACGTTTGGCTTTC No data
Right 1178028758 21:28499850-28499872 ATGAGAAGCAGTCATACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178028758 Original CRISPR ATGAGAAGCAGTCATACTGC AGG Intergenic
No off target data available for this crispr