ID: 1178040247

View in Genome Browser
Species Human (GRCh38)
Location 21:28632980-28633002
Sequence CCATAGGAATGGGAGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178040247_1178040254 4 Left 1178040247 21:28632980-28633002 CCTATTTCCTCCCATTCCTATGG No data
Right 1178040254 21:28633007-28633029 TAGCATTACTGCCACTTGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178040247 Original CRISPR CCATAGGAATGGGAGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr