ID: 1178041132

View in Genome Browser
Species Human (GRCh38)
Location 21:28642259-28642281
Sequence TCCCACCTCAAGATCACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178041132_1178041133 1 Left 1178041132 21:28642259-28642281 CCAAAAGTGATCTTGAGGTGGGA No data
Right 1178041133 21:28642283-28642305 AGTTCCCTTGACCCCCTTCATGG No data
1178041132_1178041134 2 Left 1178041132 21:28642259-28642281 CCAAAAGTGATCTTGAGGTGGGA No data
Right 1178041134 21:28642284-28642306 GTTCCCTTGACCCCCTTCATGGG No data
1178041132_1178041143 15 Left 1178041132 21:28642259-28642281 CCAAAAGTGATCTTGAGGTGGGA No data
Right 1178041143 21:28642297-28642319 CCTTCATGGGCAGGAACTGGAGG No data
1178041132_1178041139 12 Left 1178041132 21:28642259-28642281 CCAAAAGTGATCTTGAGGTGGGA No data
Right 1178041139 21:28642294-28642316 CCCCCTTCATGGGCAGGAACTGG No data
1178041132_1178041144 16 Left 1178041132 21:28642259-28642281 CCAAAAGTGATCTTGAGGTGGGA No data
Right 1178041144 21:28642298-28642320 CTTCATGGGCAGGAACTGGAGGG No data
1178041132_1178041137 6 Left 1178041132 21:28642259-28642281 CCAAAAGTGATCTTGAGGTGGGA No data
Right 1178041137 21:28642288-28642310 CCTTGACCCCCTTCATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178041132 Original CRISPR TCCCACCTCAAGATCACTTT TGG (reversed) Intergenic
No off target data available for this crispr