ID: 1178041134

View in Genome Browser
Species Human (GRCh38)
Location 21:28642284-28642306
Sequence GTTCCCTTGACCCCCTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178041132_1178041134 2 Left 1178041132 21:28642259-28642281 CCAAAAGTGATCTTGAGGTGGGA No data
Right 1178041134 21:28642284-28642306 GTTCCCTTGACCCCCTTCATGGG No data
1178041128_1178041134 4 Left 1178041128 21:28642257-28642279 CCCCAAAAGTGATCTTGAGGTGG No data
Right 1178041134 21:28642284-28642306 GTTCCCTTGACCCCCTTCATGGG No data
1178041126_1178041134 9 Left 1178041126 21:28642252-28642274 CCTAACCCCAAAAGTGATCTTGA No data
Right 1178041134 21:28642284-28642306 GTTCCCTTGACCCCCTTCATGGG No data
1178041130_1178041134 3 Left 1178041130 21:28642258-28642280 CCCAAAAGTGATCTTGAGGTGGG No data
Right 1178041134 21:28642284-28642306 GTTCCCTTGACCCCCTTCATGGG No data
1178041125_1178041134 30 Left 1178041125 21:28642231-28642253 CCAAAATTGAAAAGCTGAAATCC No data
Right 1178041134 21:28642284-28642306 GTTCCCTTGACCCCCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178041134 Original CRISPR GTTCCCTTGACCCCCTTCAT GGG Intergenic
No off target data available for this crispr